Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0002 chr2L 9410–10052 (642 bp) CG11023, l(2)gl activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0031208CG11023overlapping BDGP FlyBase
FBgn0002121l(2)gl429bp upstream BDGP FlyBase iFly
FBgn0031209Ir21a12413bp upstream BDGP FlyBase
FBgn0263584CR4360912542bp upstream BDGP FlyBase
FBgn0051973Cda515992bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgtgctggtgcaataacttgttctcatatctgattgtaacagagaatctagtttttcaataaaatttccccaagtaaaaacaatgcgaatagggacgtattaattgccgaatctcttcgagttaataattaatttttacaatacagcaagctgagaatatgcaattgtaatgtccaattcaatatttgtaatttactattttaagcctaactcttatctagggattactcgattccaactatattagagtagaagaaaacaatttattgtaacgaagtacaaagatcattctagaaaatcactcatacaaacctctaaggctcaaaaccgaggtatgatctttaaataagtcaaaattaggagttttcagtttgagacctacaactaaatagatcggtgttcttccacaaaatattgtaaagccagtttgttaaataaaatacatgttttattaataatcctaagctaaatactcaattatatactttatatggtcggaaaagcttccttctgcctgtaacatacttctcaacgaatctacaatactattgtatatactataccttttactatacgagtaacggagtaacggaggagaatgcaaaaaagctaagaacaaaacaattactacaaatcgtcagga

PCR verification status

Line verified as correct.

No slide loaded.