Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0011 chr2L 23791–24839 (1048 bp) Ir21a, CR43609 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0031209Ir21aoverlapping BDGP FlyBase
FBgn0263584CR43609overlapping BDGP FlyBase
FBgn0051973Cda51611bp upstream BDGP FlyBase
FBgn0002121l(2)gl2416bp downstream BDGP FlyBase iFly
FBgn0031208CG1102314308bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

atccagctggttagcactaccggagtgtttgagccaagtccatctgcatagagcttgtgggtgtagagtacgtatgggcgctcctgtgtgaagcgcattatttgttacaaaaacgtatccctattaagcaatactcacgcgcatcgggtcagccatgagcgattccccaataactagtaaatttacaatgtttgaggatagctccgaagacaaaaaatcacgaagtctccattgggtggaccttgagacaagaactacacgactttcagtttgcgggcctaaaatctttcgcgtcattaatgggtccgaaaggaaaagaatgtagcttttgcaattgcaatctatatggctcgtaaaacgtttattttttgcttcgtagtctgcattgatttccccgtggtagaaagtaataggaatagtctgaaaagtaaataaaattgtattcatacccgttattcgtagagtaaaagggtatacgagattctttaaaataaatgttacaagtacaagggagcgttttcgactatgtaaagtatatacattctacatacatattgattctataaggatcaatagccaagtcgatatggtccgtatgaacgtcgaaatcccaggaactataaaagctagaaatttgagattaagcactcacattccaaaaacaaagacgcagcgaatgtttgttaaatgatgtaactaatgattttatgctatataattttgatatatctgcgagaacctatttaaacacgattactaacgaatgtctgttgcttatacggatacgatatggcctgatatggctatcgcccagttcaggtccataaggtgtacagattacatgtaaatacctatattgataaaaaatgtagtgaactcattatataaccttagtttgatattttaaatgcaatgttcttatgtattagtgcactaaaggcttctttcgagcttaccttgaacaaattctctagaattaatccgtcagatttttccacaaagctatcataatatatgaccggtgggcatttattgaggtactcttgggc

PCR verification status

Line was not verified.

No slide loaded.