Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0013 chr2L 26520–27246 (726 bp) Cda5, Ir21a activityactivityactivityactivityactivityactivity
active
procephalic ectoderm AISN, procephalic ectoderm anlage, head mesoderm anlage VDRC

Annotations

stageannotation termintensity
4-6procephalic ectoderm AISN4
7-8procephalic ectoderm anlage3
7-8head mesoderm anlage3
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0031209Ir21a1366bp downstream BDGP FlyBase
FBgn0263584CR436092284bp downstream BDGP FlyBase
FBgn0002121l(2)gl5145bp downstream BDGP FlyBase iFly
FBgn0031208CG1102317037bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cttacgctgccggctcttcaacttcattatcgattcgggaagatcgaattccagattttccagtccaggggtaaatgtcggggcatggttgacacgttttcatgtaccggacgccggacttgtgccacaaattacacacttttgggttgttgcagcgtttgggccgatccttgttgatattcaattgttttttttggttttaattggtttcctgaactagattgttaatcaactgtgtatacctaccgaataatcgcactgaaatggttggaatgagtttatgcgtgatatcggtgtagggtctcgcacccattgaagcgcttgccagttggttattatccacacatcttgcattgcattgatggcatcaagaaatttaataaagccctctttgtgatggggctgggtaaaccatgcagcgtggtaaaacaagccaaatggtgctctaaaatacatagatgaagaaattaaataagccatagggccattgtttcaaatttaaacctaaattaagagtttcagtagaggtttacctgtttgtagtgtaatgacgttcaaagttcttcataatcatctttgtcactccatctgcatcactagggttggaacaggcatcgcccatagaacagcggcctccgttaaggtcctgccacatgaccataggtacctgccacaccccaggataggaacgggtcgggcaaggcggaatcatgcagtcgtggaatat

PCR verification status

Line verified as correct.

No slide loaded.