Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0016 chr2L 34214–34809 (595 bp) Cda5, Ir21a activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0031209Ir21a9060bp downstream BDGP FlyBase
FBgn0263584CR436099978bp downstream BDGP FlyBase
FBgn0002121l(2)gl12839bp downstream BDGP FlyBase iFly
FBgn0031208CG1102324731bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gctggcgttgttagagtgagtgtgctcgagtggctggctcgggtatccagtttttgtatggccacatgttctgccctgatagataaatgtattgtggtttggtgtatacgtattggcttggtggttgtgtaaaaattttgatgcatgtgtagtgagaatatgaagttttacacttgttagggttctaactagttttgcgggatacttcttattgcaggaacttttcatgcttgcaaggctgactgtttttctgggattgagttttttcgtggatgatctcttttaaaatgctttttaaattaacgaatgccgtggcttcaaagcatttaaatggaattacttacctttgaggagtacgtgttggatgatcgtacgcattatcctgttcaatctaaaattatgggtaaacataaaattcgtagtatttaaatatatatatagtttgtgaaaagaaacggtatttaaaagttacaatatgagaaatactaatatagatttttctgtacctggctattaatatcctcatcgtagtctgtattgtacgctggctggttttcgtaagaggggggcttcggagtggcgggaagctctaaggg

PCR verification status

Line was not verified.

No slide loaded.