Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0019 chr2L 39832–41927 (2095 bp) Cda5, Ir21a activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0031209Ir21a14678bp downstream BDGP FlyBase
FBgn0263584CR4360915596bp downstream BDGP FlyBase
FBgn0002121l(2)gl18457bp downstream BDGP FlyBase iFly
FBgn0067779dbr26752bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tcgtttgttttgtgcctctgtgggtgctagaaaaaagattgtatttaaatgagtgtttggttttttgggaacacattttggaatcacgagaatcacgcaggaatataatgtcaattgttcacgtattttgacgatgtggaaaaatacaagttattccttgtgtaagagtccatgttactttttcccttttcacgtaatcatacaaaatatgacattaaagtacatatgaccaatggctttttttggttgatggtgttatttcctcagtcgttgtaaaaggcctcttacttagctcaagaatttggtacattaagtaggtaaaacaaatttatagcgatgaaataaatggatcctaagggacacaatatatgatttttgcgagatagtgtcaaggcttcaagtaggcatttagctttatttacaattgagttaccacgctccaaaaagtcatcaagtatgcatctccctctagacctctgctctgatgtgaatacttgctacagtctgctatattgacgaatccaatgatatattaacataaatatgtacgttggaggtagatataaaaatccaatcacgtgccaatggttactgaccatgcaagagagctagacctgccaacagcatttgctattgtgctcgtggcgctgtcgctaccaatgctaagcaatcagacagtctgctccactgaacaataccactttgtacgcttcgtattgtacttcgaagccagatcaaaagctatatcttgaatcgaagcaaggcatgaaagctctgttgtaacgcagctcgcagtaattcgaacacaatcttgactggttttgcttggcatttgttgcttgtgttcgcttaatatttattactttattggtgtatctaggactaataatagtcctaataataactttgtactggaaactcttaccttcaggtaatggagaaagatagctcatgtgatcacagttttctctttaccgtaccgcgcaccgagcaagaaagacagaatcaaaagcctgacaattccgaccattgttcggcttactctttttgtatgctatgctatatgcatatatacacgcgaacaacaagccatatacgtggtttgaagatgaacttgacttttatgtcagtcggaagcaacacttaaacatggtactaatggctctttcccaaagtaccggctcaaaaaacaaatttagatgaataataattttgcatatgattgttgctttggaaatgctgagctttaaaaaccaatgaagctctccattatttgtttgttaaagaaataaaagccaactctgcatgcttctatgtttttgtccagaaaatacacaaccttacatcgcgcgatagctttcgtaggttttactttttcgtgctcaaggcgatagtatatgtaaaacacaattttttttaatattatactgggtgatgatacccggtgcgacttagatgtgtcactgctgcctggcccaaaatagtacgagaaataagatggcttgaaaaagcggcatttcaacatcgcctctaaagccattaaattggtaaccgccaatagcatggccaaatttagacaaatggcgcaaatcattgcactaattgccacctcgtttggcagcgtcaaatggatcttatttatgccatcctcaatgagctgttagtcaacactgcagttggtaaaagaggtagttaggtcaaataacattaagcctttaaataaatctgttcaattacgttacgtggataaagttggaagtcttttcaatatttattttatttctttcacttctaattacttataagttggttaataatattagtttaggtcaagatgaatgttgaaactttaataacggtctttgttatattcagttatatagtcagggcctgcttgagtgccttaataaaatttccctttttcgtgttacgcgtttgaacttttaattacacgtagcttgttgttaaagacttccatttcactgggtccggttcaaaattaaacgcgcgccgagcacacccgccagataaaaatataaattactcagtgcaaaagcgatcaattcaattgcttgttgcattccgacattactttg

PCR verification status

Line verified as correct.

No slide loaded.