Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0021 chr2L 42658–44732 (2074 bp) Cda5, Ir21a activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0031209Ir21a17504bp downstream BDGP FlyBase
FBgn0263584CR4360918422bp downstream BDGP FlyBase
FBgn0002121l(2)gl21283bp downstream BDGP FlyBase iFly
FBgn0067779dbr23926bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccgcctgactttgcctattggtattcagttaactgctttaactaagataaggagaatttaatcgcttattatacctgcgggttctaaccgcttctaaaagaatgaatgccgaaaagggtgagaattcgcaacatactgtgttttgggctgttttttttatagacttagtcatatgcaacggccacctgtaccatgtcagaaagcagacacgaaaaaaaaagactttgctggcacgcagcatatttgcagttgagtgcaacaagccgtccagtatgtgcactcgttatgactggcaatatgactcttgtggcacacgttattatcaactgggcaactttttaaaatggtaattggcagctaactttcaaaattttttcgatatatagtgtagtcgtaagagctttccgttttcctctagactgctctaaacttcaggtgtgtaagatggctaatcgaaccaatggctgttctaaggattccaaaattatttctggccatagtttgcatttgagttgcccgaaagtgaatgctggccaagcattggcgacaaagacctcaagtaaacggaccgaaagtgggtcagacagagaatgttgcataaccatcaaatacacaactcgctggtgaacgagacattcgtgcttgctccactgtgtgtgtaagtatctgagatctttttgctagaggccgtagctagaccgactgcaacgacagcgacaacgctacattgtggtactagcctcaccacgccctctttaaatttgatcactttcgcttcgtgtaactgcaactacgatttatgtgctatgcaatgtccgtcgttcatgtgtcgcattagcaataaggctaccatatcttgtgtgctctacactagctagccaacaacaatccatactggagacggaacggagacttcaaaataagtttccgagcagtgactgtatcgaatctatgtagagcacggattgggtgctaccccagacggcaaagctggaattgcaccataaattggaaaccgattttgatgttgtaaaacgcttcgagggcgaaaaactgctactgcatggtagtcgcattaagtgctacataacggcagtgtaaaaagtcttaaataattataaattgggtaattccactaaaatccgattcgcaactccatttgaatgatgactatcttgttccccacaagaagctaacctcaactcagaacccgtgcctgtaaagaggtcatggcctattcaatgcattcagcaaaaaaaaggaagctaaaattataaaagggttacaacaaattgaaagtcgagtaaccataaatttttggcgaaacatccaaccgaaaagtagtcaacactgaagaagatttacatccttttaaatttatgtacatatatttatacctatgcggcgttgttatggcatttgcagtgcagcgctgccggtatatgaatgcatgctccagcggataacggttcgtttaacttcttcgcaggtcaaggtaccaagtagatatgtacatatgtatgtatgtatatcagattggctcaaaaacagtgtttattgagcagcaaccaatttacgactggcatagagtcatacggtcataagaccgttgtggcaataaccattttcctttctcttttaatttaaattaatttgataagcaccagggcaacagtagactgcaacaatgaccagatcggcctgaaccactaatccaagccacagacaggtcgtttacagcgaaaatactcgatgatgccggaaatatgtgcatagtgttgccaggcagtcgtctagtttttacattgcttgcttagtatttacaaaagtaccagcagtcaaatatttttattaatatatctacatattaaatttgacatttttgtagatcgatttgtcgcatcgattatttttttttattttattctttttattttattctcaagaacaacatcatattgctgaatctggtaaattagttcttattatattctgaattagttaacaccttggtaatgcttaacagtctgaaccttggcgagcttcttgaacccaaggcaatcagttcagtttca

PCR verification status

Line verified as correct.

No slide loaded.