Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0025 chr2L 54047–56104 (2057 bp) Cda5, dbr activityactivityactivityactivityactivityactivity
active
antenno-maxillary-labial complex, ventral epidermis subset, head epidermis broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16antenno-maxillary-labial complex4
15-16ventral epidermis subset4
15-16head epidermis broad4
15-16pharynx4
15-16dorsal epidermis subset4
15-16posterior spiracle4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0067779dbr12537bp upstream BDGP FlyBase
FBgn0266322CR4498716992bp upstream BDGP FlyBase
FBgn0031213galectin17710bp upstream BDGP FlyBase
FBgn0031214CG1137422301bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ggggatcttgattatcgcgttctctcttgttcttatttattaaatattaaaatgattatacagaaatataattttttatccggcctatattttataaactcatatggattagtatttaaaaagactacagttttcccacgctaaatggggcttactggaccacaccctaagcaactgagagtgcagcaactcataggtgacggcagcgtgaccatgcaaattagccattcgtggcttaaatgtcaactttttataaaacaattggagcggccactagtaagacaagtgaagctaatttaattattcccttaagaataaggatttgtgtttgtatcgatttcccagctactgtgtgaatggtaaattgtgttgctcatagaaaatataataatataatataatataatataatatataataatataataatataatttatcttttgctatttttagtaaaaaatactccatcaaaactgcactggtctgagctttgtccctactgctgtactaacccacccatagttaaattttactagaaatcaaataacaaacttttccaaataacgtcatcaaactatcaaatttatataaaacctgttcctttttttaagaggctgctaagtgacaataaaaaatgtaattggtagtgtggcgagttcgccaaaagcagtgcattgagccgtggtacccgaaagtaaaattggttaaagagacaaaatcaacacaaatagtaaatacctagcattatacctttatacccttacaattattcacataatgcgcggacgaattaaaatgcactgttcttatggtattcgaatacccgacggcagcctgctaagtattacgtttaaaaccaagcacttaatgatgctctaacgaaacagatgagtgcgattatgcaatcacagggcaccgctaatcgataggctcacataatcgtaccgtgccggccaacattttgtcactatgaggccgacaaccgttattaaagcgagctcactaatacgtattggagtcatattgggtttggtgaaagtgaaaggtgaacagcataccattttgcggtgccgtaaaatatattataaatgaaaaagttgcgtatccgagtgcttaacagaggagagcagctgacctgctgcagtttgcccttgagagcctttagcgtcaattccacttaaatttaccaagcagtggtctacgaaacaaacacaaaacacaacaacaaaaacggaatcccaacggcaatctcgtcaaggtcgatgcattcaacatctgcaaaatccagtttatacccacaaaggagacgaaaaagcctcgactgacataagcaaaccgtgtgccggaccatcgattgccaagcaaaacaatcacaattaacttctgtaaaaaaaagagcgagctaaggaaatatttgtgttagaaaatccttcaagtatcagtaaaatcttcaatcttaataaaaattatatggacattggaagctagcttcgacaagccgaatcatctaaacccttcgaataatcgaataagaaaaatgttatgatcaaaaaggtttatgcagcaaatagcattaaaactgtgagatcagtttgcgtagaaatagacgaacggacacggctatatagagccggccgttgatactgctcaattaatgtggtcgtagatataggatagaaaggctatacaaaataaaagtttacagcggctttttgccgtaaaagaaagttactttgccgtaacaagattggtgtaagagggttaagtggagcagctgcgtcgggccccatttaatttcacgatacggtgcatagagacgtcaagagctctatttacatgtgctacggatatggacgtcgtcggcttaacgcaatgttttaatagattgcccatttcgtagcaaaaataattttcaactgtaatgcgtaagcatttcaaggtgagtagcgccgtaaacaacaagcttgtaagggcaggcgcagaagctaagaaaagttgggtgttgccgtttggtagtctattggtactcctcgtactgtgccgacaacaatttcga

PCR verification status

Line verified as correct.

No slide loaded.