Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT13975 chr2R 5119899–5122126 (2227 bp) hig, Cyp4p2 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0010114higoverlapping BDGP FlyBase iFly
FBgn0033395Cyp4p25118bp upstream BDGP FlyBase
FBgn0015037Cyp4p17647bp upstream BDGP FlyBase
FBgn0033397Cyp4p39926bp upstream BDGP FlyBase
FBgn0265644CR4445117250bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tggagctatgtatctgcaactgcaactaagtatttgtgtgtatgtcaatacttcaatatttgatggtgcattgtcgtgggcgtgagttgttgcaggcgggagtagttcacttaccctcctcgttggtggcgcacaacggacccacccacttgcccttgacgcaacggatcttgcatagccgccgatcgcccatgggtccgatttcgcccgggaagcgaatctccgacacttcggtgaactgctgcaggatgtcgacctcctcgtcctcctcctcctcctcgtcgaactccgggtcatctggatggatgggcgtgtagccagcctcctcgtcgtagatacctggatattcgaggcgggacgagaagagcagaaggtgtgggcgtcgtgagatgggcaatgtaccatgccaagaaacaggggagggggtagatagacgttcagagggggatagagcaaatagagcaagcatctaatgagccgttgaacggcatgcgaatgaaatgcagatgaagatgctgatgcagatgcagatgtagatgaagatgagtatgctaatgaagtgccggtggacaatgagcgatcttaatgcccatccaagttgacccaaaactcgactccaagttgcgccaaaagtgcgaaagaggctgcaaaatcctcaagtacgccccttgggcacacacattaagccaaggagaagccatcgagaaaccacgagacgtgcgaaaagtgctgccagctgaaaacttcaatgggccgctccaagtgcttagatatgcattaaaagaaaaccagaaggctggcgaagtggccacttaacaggatacaacttcatttcccagaaaccccatcaaaagacggcactaaaataagggagatgtgaaaaggcagagataacaccaaagataatattatgctggctaatagaaaatagaaaaaaaaagatgaataaagcagtaaaggatgccgagaaggactcggacaaaggagccccagctgaagcccaaggcaaacaaaggagccaaaaggaaaatcattccggccagaacaaagggccaaacggccaaccggcagcggacaactctcaactctgaactctaaccatgacaaagatatggactggcaaataaaccatgaccacgcagcaccgatggcggaaatggggtaatgaaaagccgtcggagagggtggaaaatgccagaacaggtgggcttttggtggcgttttgggtgttgggtgaaggtgtgattttgatagggggatgagccatggctggataggatgctattgttagatgcgatggctgtggctttggctgtgactgcgattagcttttacgagtatgttcggtgtgtcatccgctctcaacttccgttaatgtttgggtgttcgtgtgtactcatgtgtgctgctgttggctgaaatgcccttgcaaaagcgtttcaatactcgctgctagacattgtcaaaatgttgccacattataaagctcgagggcatgatgaggcggcgcctaggctgctggccagccgcttgggagtcgtagctggcatgggtttcactcttcaatggctggctaactggtcgtatacttaattttgcatttaaaaggtataactattcaactgtgcgtatgcgtaatttaaaaattattgtatagataaaaccatttacatcctgatggtatattttaaaatattaatattatattaacaccaagctctggaaaatattagtcatttgaagcatatttaaatcgtcaaaagatttgaaagttaaagatggtttttattttgttaaccaacagttaacaggcgtgttcttgtaacggaccactcctggacttgtactgccattcggcgacccttcaacctttgcaagggatttccgagcggatgattccgccctccgtgagatctctgcgagatcggacagcgcgacacggacggacagacagacaacgagacagcgacagcgacggcaaatcaaggcttcaaaggcattgggcactgtggcattgccagtgtctggccgccgtgcgggcgcacactcacccttgtccttgcgactggtggtcttggagctggagtcgccaccacccttcggacggctcagtgcacccgtggtcttgccggacttgcgcttaacacgttgccacaacagggccactcgtgcactgctcgactgatttccgtactgctgaagatcctttagatcctgatccgctagcg

PCR verification status

Line verified as correct.

No slide loaded.