Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14208 chr2R 5563158–5565296 (2138 bp) Mmp2, Uba1 activityactivityactivityactivityactivityactivity
active
telson subset, pharynx VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14telson subset2
15-16pharynx2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0033438Mmp2overlapping BDGP FlyBase iFly
FBgn0023143Uba112636bp upstream BDGP FlyBase
FBgn0011921tRNA:M3:46A14358bp downstream BDGP FlyBase
FBgn0260474CG3000228731bp upstream BDGP FlyBase
FBgn0033439CG177330614bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcacaaaacccaaaatcgaaaaacgaacaagaaaagaaaaaaagaacaggcggcaggaatgaatctgggtcaatccaattgttttatattctgtttatgtttttctactctgtgcagcttttcgtggcgctcttagaactccagcaaatccaccaacgaatttctggcttgggctatacatatatatttatttatgcacttccacctttgccagcgccaacctcttggatttattgcgcttttattcttcctgccattatagaccgttggaaacaaatctgcatgcgggttttgagtgtgaatgcatgtgtttctcctaatggctggacgtccgtccggatctttttggtctttcagctcctttcagcgcttcaccccgagtgtatcttttagtcctcctcgggctctgcgtaagtgaaatgcaaaacagataaagctgaaactccccccacaatgattgtgcaattccgataatgcattattcgcttctcagcacttatttgagtgatatgctcgagtggtaaaagcataaattcatgactgtttagaaaatcactgattgctctgctttaatgctcaaaaagccaccaagctaaaccttttctcgaactttaataattataattagttggtatgagttattagtatcaagacataaaatcattatggtaatatatttaagctttatatattatgacataaaatcattatggtaatatatttaagcattacagccactatatttatatcgttcaataacttattaaatatccaaacccaaaaaatatacctacattatctttcagatactttttctgtcaattaaaatatgagctatcggatttttcgacctggaatttgtcctttattcacctctttgcggaaatgaatcatggaaactgttaaccaaaattggggacagctcagtaaatgtaaataccataagtatgaatgttgctgaaagattatagaggactggtcgtccgtacggatgtcagcgctggagtccgcatccgcatccgtatccgcgttggcgttccatcggctaatgtgcatgcagattgagtttgagcgctggttggcaggcagactgtcagaaattgtgtatgcacaacaaatgtctcatatttttgggtacgcagccataatgatgcataaaatgcagtgagacaacgaaaaaagcagcggaaagcgaaagaaaatcaacataaatgcatcaatcatacgccgcgtgggtcggccagacgataacacttcaatctccacattctctttattcctgtctctgaatttcccatcccccgaatgacattaaaaatcaatcaatggcacattaaattaataaatacgacaacaacaattgagatcggcgggctactgtacatgatgttctgcttgcaggcttatcgcccagctgagtgttttcttttcgatgcgcttttttgtgttttcagtacagattaattaagtatataattcaaacgtataaaaaccgtaatgcttcctatttacccgcctttgtatacattagcttaagcgagcacgttttcatttcgacgccgtgtaattgcaaggaagatggcatttctgagatcgcaattaaaatcaaaagataatgaatggtcgagttcctcagctaatgggagtgcgagggggatggagatattttagttgcctacttagactgcttacaagagccgccacctatcggcggctacatatatttctcataaatatccgaagtctttagtccattgtgcgttataagatccttattttttaatatccttcaaatgttaaatgttacttgaaactgatagttcgtaatcctgatccggaacatatacacttatattaaaggccggaaacggatcctagccattacgtactttctagcatatgtattttacgtattaagcttctgaagatcatggacccgtatatttcttcacaagatttcaaatttttatttattaatgaaaaatacataagttgatcctgttgtaaagaaactggatgtcatgttctcgatcaaatccccttcccttattttcctttttccacatatatgtatatattttttagcacataaactaccgtttggtactaacgggatttttgtattccgctcttttacca

PCR verification status

Line verified as correct.

No slide loaded.