Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14717 chr2R 6573526–6575627 (2101 bp) stan, CR44452 activityactivityactivityactivityactivityactivity
active
ventral nerve cord subset, ventral nerve cord primordium subset, brain subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12brain primordium subset2
11-12ventral nerve cord primordium subset3
13-14ventral nerve cord subset4
13-14brain subset2
15-16ventral nerve cord subset3
15-16brain subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0024836stanoverlapping BDGP FlyBase iFly
FBgn0265645CR4445228477bp downstream BDGP FlyBase
FBgn0005586Rab335314bp upstream BDGP FlyBase
FBgn0033541CG1293436192bp downstream BDGP FlyBase
FBgn0033540Elp237388bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tcgcttaaaccccctttttcatgcttccattttcgcattccacttgtaatccttgaaaaagtcgctctgtcatcatctagctttctgatagttaggcaaacaatgtaaaattgcaattaattcatggccaaatatttgttttgaattatttactctcacttctttttttttgttaccgattttaaggacaagggcttatttgcatatagatttaatttcacgcagaatggcagcaagtatccatgagcagcagtttctatgagggattttctcataattgcaaattaatttgcattttaattaatttctggtcaagtcccaggagaatcaaattgattgcaaacaagggaaaaaaagaacgagagccctgaaaagcgaacaaaagcaattatcaaggaatatgaaaagtgggagagatcaaaaggaggcagatgctgcaaaaatcaacaatagcgccgagtacgaaatttacaattgaatgcgtttcagtgggtagagccagtgcagctattgtatttatatgtacatcctatatacgatatgtatgtttgtacaatatataggcggatgcctaagcaattaatgtaattcgtctttgcgcccgtcgccttaatggcatacaaattacgcatacgccgcgtgtgcaaatcacccaaaagggcaaagcaactggaaggggaagtggacgtggaaatggaagtggaagtggaagctgggccagattgctttacgctccatttaattttcggtaaatatgccaataaaaattgtgaaacacgatgcggacccccagatgaatatttccttttaggcaccgacaaacgctcgacatgagaaaaggtccttttgcccggcttttcgtgcgtctctttgcattttaaattgccacaaaaacacactgggcagccatctaactgctttcggactaagcgaatatttcgtttaattaaagctgacccagtgcccatcaggtgaaggtaattggccaggactaggacctctgtgaggcacattagttggcaggagctcgtcatacccgtgtgtcctctgcccggagatgtgccgcataaaagtcgattttaatgtgaatttcgtgtcgcacaaaacgaaataaatttcaataaatttgccaacgcaaaagtgggcgggaatgttctaataacttttaattagttaaccatgtggaagttttcgctggcaaactaaaagcaaatttgctgtcagcgctatttggttttgctctttggctgctgcggcaggtcgacaagtgaattattaacgcctgacaggtaaaacccgacgccttgtgcccgtatatatgtatattcataaacccccttgatttcaacccgcaggcaggaatttttcgcctgccagcttaagcgttataattaactgcgacacaaacattttcggctcccagtttgtgccttatttccgagcagtgggaatatatttttgcggctcaggctaaaccaatttgccaggacttaatttttaagcattattaatggttttgcggcgggacgggtgggcagataatgcggattctggtggtgggtggaaaaatgccgagtcttcggtggagtaatcaccggaaatcttggactgccgtcgagcgtgggtcaacaaagcataattttagtggttgactgcggccatatttatatttcaatcatcccccatttcaggtcttcgatgcatgtgtcacagatatataatagatattttcaattttattaaatacgtattggaaaaaactgttcgttttcgactcataaagcaatttaatggtaaaatataaaattgtttcaaatttacatgtcttgctttttcgccctgctcgattcatggcatatgcataataataacttcatatttagttagttttttcatccaaaattttagtttgctgtacttcacccaacaaattcaaagctgacgtattctgaaaatcgacgggctctagactctagtcaagtgtgccatagccaatgagctcgtgacatgagcaagcgattaagggatataagtaaaagcatctgacatttgctagctgaactgcatggcactcagactcgccccagtttttaccaacggac

PCR verification status

Line verified as correct.

No slide loaded.