Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14724 chr2R 6585899–6588021 (2122 bp) stan, Rab3 activityactivityactivityactivityactivityactivity
active
ventral nerve cord primordium subset, ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12ventral nerve cord primordium subset3
13-14ventral nerve cord subset3
15-16ventral nerve cord subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0024836stanoverlapping BDGP FlyBase iFly
FBgn0005586Rab322941bp upstream BDGP FlyBase
FBgn0033542CG1230926876bp upstream BDGP FlyBase
FBgn0033543CG1233831184bp upstream BDGP FlyBase
FBgn0033544CG722032962bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcggcgaaattaaagacaccaggattatcctgcacctctgtggtacccgcacttatcactggcaactggcggctcgagactttgtgacaaactttttggccaactgtcgatgctgattaccaggccaagcccactgccgctccgccagtcgacagccggaacagtcggctgggaaataggatacggaggatactgctccatggcactccgctcctcgtgtaaagcactcttcaagtggcagccactcgcattaataatgcctgaagggctgctgctgctgtttccgctggaggagcaggagcagcatatacgcacaaaagtgtgcaccacaagttgtaacttccagtgctcacagagatacagatacgagtatgaaccctagaaactctatggaccgggctgcaagcacaaagttgggataatgtggacttttgctatctttgttgctcggcaattcatatgccaactgtgtgtttatttatgcttacgactttttgcgtaatcaagtctatctcttcagatacccctttgagtacttttgctccaggggcatgatagttttgcgtgatttataccgagaaagagacaaaagagaaattgaattaatatttattattaaaatatactagttaacaattgttaggccataaattaaatattacatatgtccaattaatcaagagaaaccactggggcaaacgtattgcaagtatattgtttattaactatctcaaatgaatattagatttcttggctagaagtttgaattcccatcaagacacaaacaaactgtgtttgccatttgcaaactataaggcgcagaataaatttgcaaatggttttccagggaaaatctcatcaaagccaagccaaagtattcacttacacaaatcacacaaaaacctattccggcagagttcaaatcccatttaaaatgagataacatgtcttgcatgtacatatgtgtatttgatatttgggaaagtaaacttttcctagatttacttgtgggggttgccccccgattcgaatgtcttgcacaacataattttccggtctcgattttcggaattgccgcagtaaaaacaacaagatgccttttggccatggatttggatttgtttgtccatgatgtgagttgccaaatgttgcacacgtacaaacacaaactgttttgcgtagtttgtttgcttaaatcgcagtcaacaatcgaaatggaaattgtttgagcctctccgtgggctaattactggacactctgtgtccatggcacctgttgttgtttgtttgcttgtcagcaaattatttgtcattgctgctaattaggcgttgtcttcagcctgcaattgaatggtaatggcaccccgttttccccatctctacgtctccacatctatctaccccttcggacaactccaattggcgtaattcccctggaaggtgagcaaactggagctggcgcagagtctttgattaatggattaggtgcagattgtagattgctcatacgctcggagtgctgctggtggaaggcaaaagtcattacatattgataatgcccagccattgtctcgactgtgacctacattgctgccacctacatccccaccatccgcatcaccatcagcatcagcatcacatctctaattctttgttctctaccctttgccctgtctccttttggccatatcctgttacggtagctgaaatcgcatttagtgctttgccgctccttgtttgtcttagtcattagcagagttgatagctgatgggtgatgcctgatggctagatcccccatcttctgctccttcggcttcccgcacctcctcttaatgaaatcccacccagtgtgcatatgcattccaatgatccgattcattgacggcactccggctccttcccagccatttgacaggattatccattatcccctgtcgggccccttttcaatttacttaaatcgcctcgctccgtcgggaggataaatcactggcaatatttcataggcaggactgcataaattccccataaaactgcgactccaatgcgaattaaatcgcattaacataatcaactttacaacaactataaaaataaattcaatgggatttgcgctcgactg

PCR verification status

Line verified as correct.

No slide loaded.