Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT16116 chr2R 9220057–9222240 (2183 bp) CG44206, mir-184 activityactivityactivityactivityactivityactivity
active
head epidermis ventral anlage, head epidermis ventral primordium subset, head subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10head subset2
9-10hindgut anlage2
9-10head epidermis ventral anlage3
11-12head epidermis ventral primordium subset3
11-12head subset2
13-14head subset3
15-16head subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265104CG44206overlapping BDGP FlyBase
FBgn0262391mir-1843052bp downstream BDGP FlyBase iFly
FBgn0033828CG1704821086bp upstream BDGP FlyBase
FBgn0033827CG1704731006bp downstream BDGP FlyBase
FBgn0033826CG473434086bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

catctcgcacacggctttcctttacggatattttcaggcggacagttgatggtgtgcggtgtgtgtgggtatgcaaatgcgttcgcatttcaaatgaatgtggcatgcaaataccgagccgtgcacaaaatcgttccaaatggttcgaaatgtggaaatcaaaacaatcaagtgaagcgtttagccccggccgcaccaactacatacaatggatgaatgagatggcagcactcggcgagaaagagacgacgcgatgcgagacaaatgtcataaatataaaatcaaatgcaaattggaaatgcagacatagaggccgctctatgcagcagcagcggcaggagcagcatacagatgcagatacatatcgagatttagatacattttagctcaactgaattggaaaggatttgcgaaacattcaaattgcggcagagcgagagcgcagctgtggcagaatgagacagcgcgacatggccagaatatttgcatttaattagcaaaaagcccggcacatccaattgccggtggatgggcatgaaatttgtttatggacaactattaacattttccaattacacaacataacgctcataaattatgccatgcatgtgtaattgtttcgagccccttttccctcctctcaccccgctctgccccatcattccttgcatttgtttgttgtttaattaagtataactttgccgtggacaaatattcaataagcaggccacaaaaccaaatcaacggaagttgttgttgccgttacagttgcaacattcgagtaattaacattaaatcataaatgccacaaaacgctacggaaacgagcaatatagccgattcactttgattatgattgtcatacggatagacacataaatccgaacgcgaattgcaatccaaactgaaaactgcggatcgtatttattctggcaactttgtctcggccctttcagtttattatttccagcagtcagcacacacaaagtgctgagctctggaatgtgtgaacgaacgggcatcgcatttctgccattttgggttccttgaattgagattaaacgccaattcccaagatcttaagtcacagctcggggatagtttttgtgagcatgcgataagagtagtgccggatagggggactctatatacacatgtacatgcatatacatatgcaaatattgagctggcatttcgagggcaggcgataaaagtcgagctgcaatggctgcaaagataaccatgtggctcggtgacatcaattgaaggccattgtttggctcgcaaccgaagtgaaccaaaccaatcctaactgaaccgagccgaaccgactgcataattgatgccgcgctcagccagctcatttgcctaccaaatgccttcgagaaaatgccaatcaattggaaatgttttcagcccgacatgtatgtatgtagttatacttattcaccattaacccccatccctatgctcttcttctggatcaagacgctaattaatcattgcgatgtttgagggctggggcagcaaagtcaatttaattgatggcaggatgaaaccggagccaccaccaaaacatccggcaggacgaaccgcagacccagttacatttgtgatccttcgagctggggtttcccaaggatgcagaggctcgtgtgatttgcatggctaatttgacagattacatggaagacattgtgtcccgtctagatatccaaccacacacgcatgaccaaaccgaatgtgattaattgcatttaatgatgcgacaagcaaatgaagaaatcagtaaaggaatcgttgtttaattcaaatgtgttgaatctaaaaatcttaggaatgtagagtgaactcccaacaaaattctgtttaatcacatttaaacatttatagaagaaatatttgttcaatcaaaataggaactgtgataaaattctagcctatgaaaaattactctagcttgaaaaattcttcagctttgaattggattcgaaatggatgctgatgtgcaaactagttttaatagcttgtaatgattttagttcgttttcttatagattcccatctttagtttgcctaatatttttagcttcaaaccgtctttaatcaaaagtttagtttatgttttcggtttcctttctcatatgagtttgcgttgtaaaagtgatggatgggcagtggctc

PCR verification status

Line verified as correct.

No slide loaded.