Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT16984 chr2R 10950980–10953110 (2130 bp) CG33467, CR43622 activityactivityactivityactivityactivityactivity
active
head mesoderm anlage, head mesoderm AISN, head mesoderm primordium VDRC

Annotations

stageannotation termintensity
4-6head mesoderm AISN2
7-8head mesoderm anlage3
9-10head mesoderm anlage3
11-12head mesoderm primordium2
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0053467CG334677235bp downstream BDGP FlyBase
FBgn0263613CR4362213121bp downstream BDGP FlyBase
FBgn0029082hbs22098bp downstream BDGP FlyBase iFly
FBgn0265650CR4445728470bp upstream BDGP FlyBase
FBgn0043530Obp51a38637bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccagatcttaaccctttcgccagcataactagtttgcaacagtcggcgcagtcgaggcgataatgttatctaaacaagcataaagttttgcatcaagggctaaaaatctaaatattattaccagcatccggtcggccagaaccacactacccacctccccactccttgctaccaacattgattaacttcatatagaactagtttactccttcttggcaaaagttctgcatcatatgcccttgcttaaggtgttgttactatacgggccatttagaactttaatgtatcacagtttctatatataaacgaggtacattgaggtgaaagtccacatttcttttatatgtatataaaagtgaaagaatatattattatgaattgtacatatttagaagtaaatgcgcaaaatgacaaagatttgaaataaataagatacattgcatatgttgcatatatttacttgttatttaaactaaattgtcgtgcaaatatttcttgaaagggcaaagcaagtttggcttttcaatcgaatctatttcccaaagatttatttttagctcaagctgttccgttgattgtgggcaattgccgggagttggccaaaaggggcgatgaagtgtgtgccttaatttgcctaaaggaagttgctagtggctgttttaagaaaagggagaactagttggccaacaacagcatctgatcaacattgtggcttttaatgtggcaagcgaggcgcacatacgatttcttgccccagtggattttaaagtttattgctacgtttgagcgcactccttatttatttgcagcaaaggcaatataaaagccggattaaacgttttatttcaaaataaataaattattgattaatgtagggaacgtcttaacagagggtagtacgttttgtaaattctattggtaaactggttaattaatgtaaataaaattttatatagcaccaaaaaatatgcatagctttgaaacactgaaaaaatatgtaaaacttatatctttaattgtatttttctaacacttaatccaaaatacagatttgaagttttgatcgagtgctattgaagccaattactaaaaccgtaatttctgatttcctattccaattgcgttgaaggccttactgtgcaaataattaagatgccatattccagattgccatcctggccataaaatcgagtaaacagctcctccagacgttgccacaagctgcatgcaagcaaggttggctgattgcacacatgcacatttggcttaatccatggccaagacccaacacgcctcgggccctatacactacaagttgcagatttcttgcattttattagccaattttttgtgtacattgccggaaacgctacgaaatgttgacaacgtacgacatgcgacaaatgtgcctgattactcgaaattagctttgatttgctggacgttggttgtgatgggggcaaaacggcaaaaaaaaaacaaaaaaaaacgagagggcgggcgataaggaagagggcttgaaaaaatgtaccagactgacaatatggccaaatggaaattgctgtgaaatgtatgaactaccaattctgtttgcagcaccaacagcaaaaaccactttcgaggggcggtgatgggtgatgggtgatgggtgtgatagggggtcgcataaaaaagggggaaggccatcgagacattgacacaataacacctaaacttgcattgtccgccccgcaatattgactgccggaaaagtgctcgctggcttgaccaaaagagagatggaaaaaacaggacggaaaatgaaaaccacttctggtgagcccttcgacaaaaaatccattttccactcactcaccccactcctgcccatgggccattctgaattcatgcatgaattttgagagggaacaatttttatacctttcgcaatattccggcagtgtctgcgctggttggcccctagaaacccagcagtccgttacttttcaatttccactttccacttgcgacttggttacccggtgtcttcggtgcgattttccgcaacgctgcattttcattaccatcaagtaaatgggtgcgagcagtcgagcaaactgactttgtctcccactcgatccatttttgggtt

PCR verification status

Line verified as correct.

No slide loaded.