Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT17255 chr2R 11505786–11507927 (2141 bp) CG42524, mir-278 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0260429CG42524overlapping BDGP FlyBase
FBgn0262403mir-27838785bp upstream BDGP FlyBase
FBgn0023441fus39037bp upstream BDGP FlyBase
FBgn0034033CG820444291bp downstream BDGP FlyBase
FBgn0050466CG3046645112bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gggcaattgttttcatgctgcactctatatatttcgcagcctttggagtgcaatttgtgtcggtaggaggctttgattgcaatttcagtttgtagcccgaaaagccctaattgacatcggaggccggggagctcaaagtgaggtcctggggaattgcgaatccattactagtccgagcacagctctggctcgagctctcttgtcttgtcaagtttatggcttggccaagcggtcagcatctcaattggccgagagatgctctttccaattcccgaattcccataccgatagtgagcatttgccaagccaaagatgatgccgggcccataaacaaagagtttgaaatgtttagcacgaataaacggcggctattttcattcgcattacgtcaacaaacgcagatgttccgattttagcggccggcacatactatacatatgtatgttggtggagatagatccacatgtttgccgtttcgcaaagcggccaatacataaaagttgccataaacaaacaaagatttcgcaaccagcaacggggagagagatttgcgagagcatctaaccgatttgtaaacagagatcgaggcggaactgcaaatagctaggtgatataggaaaatcgtggtcagatttcgttagaatcagcaaccagcagctttaaacgcactaagataaatgggtaacaccatatcaataactaaatcaacaaagtatcggagtattgtactgtttctagttactaattacagttcttagctactatttatacgttcaacatccatattgctgccacataaaacaaaaaaacagaaatatataacagcaagaagccactctagacacacaatttatccaaaattctgttattatcagtgtcacacttgaggcaaaaagcaaaaatcaatctagagcctgaagcaactagcaacatcctgacttcggcagcaaaaagcaaacatcaatctagagctagtggcaactagcaacactgtgacatggcagacaatagaagcaacaatcagtagcagcggcaagtgctgtgagcaacaacaagcaacatcctacacagtggtagcagccacataagaccggtggcagccatcaggaacaccaatcaactctgtcatcgggggcgttgctttaatatgcagccggttgtcaaaaagattatggcacataacgacaacacctgtcgctgcctgctgatgctgctgctgccgctgctgatgttggcgatggcgatgttgctggtgttgcttcgactgataacacacggagataatgacgctcaacaatctgttgctcggctgatggcctggagctgctgctgttgctgctggtgcttcctttcgactgtctcgcatttaatgtggccacataaattttggggcaaatcaaaaacgcgttttatggcttgccatcgccgatgctgctgccactgctgctgtgtcctgacttggtccgagggctaacaaaatttattgcattttacaagcatattacaaacgctcagcccgcacgtacagagctttacccgctctcccccccccctgttttccctctgccctttgttccgactcttcaattcccagcagccacataaagcgcgtcatgtccgttgcttgtccgtgagctgtccgtccgtgtgtccttaatgtccgtattgtccgctcctctgctgctctgctccccgactgctgagcccctcgattcttcgtggctgccaaattgatgcagactcagtggcgccaggagcggcagcagattcagcttttgaccatggttatggagcaggagaagtggaattggaatgggagagcagtcaagattgatggcccgttgaattgctcgctctgcggctattccctcgacttcttcagagcccgtttctcgggcttctgtctcaccatatgaattactcattgctcatttttgctgcaatttattgtcattgttggtggcgcggctgccactgctgctgctgctgctgctgctgctgctgcagttctgatgccgctatcgcaattgcaatttttcttgcacattctttatggcaagatgtttttctcgctagatttttcatgtcgtcgcgggtctctttttctcgccgagtgagcgagcgtggccgagcatatttcgt

PCR verification status

Line verified as correct.

No slide loaded.