Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT17419 chr2R 11802313–11804425 (2112 bp) sli, CR44373 activityactivityactivityactivityactivityactivity
active
dorsal epidermis subset, ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14dorsal epidermis subset3
15-16ventral nerve cord subset3
15-16dorsal epidermis subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0264089slioverlapping BDGP FlyBase
FBgn0265511CR443731187bp upstream BDGP FlyBase
FBgn0034049bdg8232bp upstream BDGP FlyBase
FBgn0015247Iap217362bp upstream BDGP FlyBase iFly
FBgn0053463CG3346318382bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccccatccaacaaaatgtcgattcaaaaggaagtcttccctcatatattgaaagaatttacaattttgagaactttcactcgttgccaagtaagtctttccaacaatggaaattctgatgatgttaataccccaccacaagaaaatcagacaaatttatgtgagctttcaattttataattgtataaataaacaactattagcggcaccgaaatgcgacataattgtccagtaatcctaactaatgaaccgacacagaagatgaacatgaaaaatggaaaatgtgctgcccgaatggtaatgcgaatgggaatgggaatgtaaatgcagatcaggccagtctcagtcccaagattgggaatagaccaccaggtgtcaccgtctcacggtttcccattgttgtttcttggtcgctgcttctgctgaccaaatccggaaaaaaaataaaccgaaatcaaatcaacaacaaataaatagaaacaaaaaaaaccgagacaaaaaattcaaatgcaaatgcaaacaaggccataaaattgaaaatatttaattaaaacgatgcgacacatatcgggaaaatgaggcggaaggtgaggggcctgagaaatgcccaactttcctggttttcaacgtgggctgaagtctacgatctactgtagcatgttgttgggtgtctttaactgtttgcggctcaaatatttggttgcaacgaaaattagagaaaaagaagctgttccgtggccaaaacggcggaggggtacgggacgcaaactacaacagacagcgccttttattggtttgtttgtgagtttgtgtgtaggcttcaaacgatgagatggagacaacgatggcgacaatgtgacaaccacaacaatgacaggctgctgcaaagagagtaatgttccgagagcattcgaatcgaagtgggaataccctatagataggaaagtgccaaaaggattgctcaggcttttctacaactatcaaatggtgctcatatatcattttctggcccatttctttcactttcttttgttcggcattcaactctatttccattttcattcatttaagagataaaatgattcaattttaacaactttaagctggaaatatttacataattaagatatgtgtggcacatgttcaaaatgtatattttgaatataaaacgtttctttaaatcactggaaagttctgctcacacagttcgattgcgttagtggacataccctgctattggtcagggtatttatgtataatgaggagtcggcgcagattttattgcagcatcacgtctacgtcaacgttgtctaccggatgcctgcaatatatcaaacgggagtcggctctcaaactggccattgcatctgtcccgctctgtgtttccctatagaaaatccgcattaccacacccccaccaccggcgactggcggtgttttgtctggctcacttttaataattccgccccgagggaccggcgaacggatggtcacctacacacaacggcaatcggaatgacaaactataacaataggaatatactccaggcaatccaattgcaatgcccgtcgtctgagtgtccctcgtctgagctgcccgtgaacccccttggatccggccatcttccctccatttgtgtgcagcgaggcatagaaattccaagtccgactcgcctccccccctgctccggattcagttgtccatccaagcactgccgttaattatgggaagatttcccattgtacaaatgagttggaagaacaacttttgtcaggcctaatgatgggtagtggacgtggtagtggtagtggactccggggaaatgtcgcgtctggttagcttccaaaatttatagaagaacgcctcctcgggatggccggaagaatgcaaatggcgggggaaaagagaaaccaaattggtttattacattctttcattaggaatgggaatgggaacgggacggagagctgtcgcccgaaatcaacgacaatcaaataaagtttaaatacatatttttatttcattacacacttgaaagtctaagccccgaaacgaactgtgtctcgagagccggagatttcgatgatgacgatgacgttggcgatgatgaggc

PCR verification status

Line was not verified.

No slide loaded.