Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT18278 chr2R 13447149–13449319 (2170 bp) Klp54D, MESR4 activityactivityactivityactivityactivityactivity
active
ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14ventral nerve cord subset2
15-16ventral nerve cord subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0263076Klp54Doverlapping BDGP FlyBase
FBgn0034240MESR43356bp downstream BDGP FlyBase
FBgn0263029CG433243962bp upstream BDGP FlyBase
FBgn0034242CG144804696bp upstream BDGP FlyBase
FBgn0034243Ns26135bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcactttggggcttcgtgttaattcctttctattggcgccttatgaaatatttaccaagtgcacatatttaccacagcaggcccaactcatgtctgattaataatagtagagtgaagtatggccattagggcatgaatgtttaacgagtcatttacgtgaaaatgttaaatgtcagctgtgtgccacatacaatcacgccaagatggggcatcgcacatacgccgtgttgtccagcctatttgcagttcaataaaccgtttgtattggaaacttcgtttgctttgttagagattattacattttctggataattactgggttagcgagcaagtgaaaccaaaagtttttggaatccttatcaataatttattgcttcatattaccatatttccaaaaagctgcgattaaattcctccgaagcgagttcgttaattcaattggaatgggacctgcgactcctagctcaccttcacaatagtgagttagtcgatgcggtggtcaaataaatcagaaaaaacccaaaagtcacgcgccataccatccacccttaaccttgactaataataggccggtcgaagtgtgagctccatcaagttcaaggcaaatccacaaattctggaaattcgcagggcccacagcaaatggagctcataaaacaatgggagctttgtttcactttgattgattaattgtgattccgttaattgcgagctacatttggcatcatagttaagcaaccatatccttgaaaccttaaaatatatacgtgttacttgttattgattaattgctacaatatattgtacaagtaatgtatgggacattaaatacaattaaaatatatcttctcaggattggtagcgctgacacgctggaaatcgtggcctccaagtccacgggcagcgaggagtgctcaacgccggaggacaatattaacgtggttgtaagagtgcgtcctttaaacgacaaagagaaaagggatcgacatgggtccacgcttcagtttcctggaaacggccaggttatagtacgtattatttttacgagcatttcaacatgatgcttaaaccaatccgctgcagcttgaaggcaacgatgtgggccagaaaaggtcgcataatcgcgatagtgtacgggttttcacctataacgtggtatttgagccgggagccacacaggaggatattctggactactcgggtataaagcgcatcattgaaatgggcatcgagggtttcagttgcacggctttttgttacggccaaacgggatccggcaaaacgcacaccctcactggaccccccgatttggtcagtccaggtctgacagacttgtaaaatccgtaaatcctaagttgtttcttttctctttaagttcgttggcaagccgaatcccaaggatccgcgtcatggcctcatcttccgctcgtttttgtatctcttccaattgattaagaatcgcaaggacgtcaattacgtgctaaaagcctccttcatggaaatctacaatgagcgggtaagtggcgcccaacgagggacctctaatttggattgacctctgcaatatcaatttaaatcctaattgcatttgccataataccgattgcttgtccgcaaacatgcattccactgacctccatccatccatggatgtcagtacgctccacccaccgaaaacagacagactggtagtcaatccagctatcgtggattgtcactatgcgtgaaatgtttctgcattttgcgtggcatttcattgatttgttttcttagcctacccaccatttccatattggtttcgcaaattgaattgcattttttatcaatcccctaggtaatcgatttgctaaacccgggaagtgcacgaaaaccgttggcggtgcgctggtccaagaaatcgggtggtttcttcgtggagaaccttttcacggtggactgcgaagaattggatgaccttctggccgtactggaagaaggtaagcagtatttatacatatgtacatacattcataaagtagttgttttgctcacattctatattgtcattatggtaggtatgagaaatcgtgctgttggctctcatgccatgaacgaccactcctcacgttctcatacaatattgacggtccacatcctatccgatcagcagacggacggtggggtgttccttt

PCR verification status

Line verified as correct.

No slide loaded.