Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT19018 chr2R 14893927–14896178 (2251 bp) tn, snoRNA:abba-a activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265356tnoverlapping BDGP FlyBase
FBgn0263473snoRNA:abba-a11581bp downstream BDGP FlyBase
FBgn02631165-HT1B15903bp upstream BDGP FlyBase iFly
FBgn0263083CG4335123587bp upstream BDGP FlyBase
FBgn0034411CG1860527144bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgccgactccagcaaccaccgcgttcaggtcttcgactccaatggcatcttcgtcaaggagttcggcgagtacggcaacggtgagggcgagttcgactgccttgccggagtggccgtcaaccgcatcggccagtacatcatagccgataggtaagttaaggggtaccacattacgtagttaagattaatgggcggaaaacttctaaagtttaacattttatatagatctcattcataaaatagctttagctaagtcctggctatgtaaaagtaaaaaattgatattggcttgtctactttggcggtgatacttaatctccgagtgggtgagcatctgctggtggtcagtctgtgttttaattaagccgaaacaaaggcgaatgattaattccccggcttccctagctcctcctctaattggcagggctaagcgcataatagccgcgttaatgagaaacatgtgccggttcagttgggcgtagtgcgagattttggcgctcctgcacatgttatctgcaacctttttacgagtgctcctggtatccgcgcgtttccagcccccacatcccagatccgatctcccagcctccggcggccactgtcattgtttgacgcaaaatctcgttaagcacccaaagacccggggtatcctcattgtgcgagtcaactttgattttgcacgttaagcggcttagacctaagcccaacacccatcagcccacgccgaacagcatcaccacaccaccaccgtaacccacggctgaaaaccaaaaatccacgtccaacaccttggaattccaaggcgtcgcattttggctgacgacccgcgaatcttttttggggaccggtaatgagatctctcttttggcacagggttcacaattaacggggggaattctccgatttgatggcctaataaattggccagttaggttgaacatgaaagaaaaagaaggtacacgcattggtggaatttggagagtgaaccaataaagtcaaataaaacatacgatttttgcttgttataatatttgtcagatgagatttaaaatttaaatttacttaatggtttcaaaacttgttaacctgtgttataactttaatgaggcactatatatttcaataagataagtaagtttcctctgttcttacttttcgcttgcagatacaatcatcgcatacaagtgctcgatccgcaaggacgattcctgcgcgccttcggttcgcagggcaccgcagatggcaaattcaattatccttggggcgtaacaaccgatgcactcggcttcatttacgtgtgcgataaggagaaccacagagtgcaggtgaggaggaaacggaggatgcacccatttggtccgggcccccatccttttcgcagcctttttcagctcgcctcgccatcttcagtctcgatttgcatgcaaatatttatatatgcagtggggcatgcggaaagttttgggcggcggagaggctcgagccttgcccaatttgtcacactcgagctgcagcatccagcagcaattttcatgggcttaactagcatatatacatatacatatataagagtgtatatttcagtttttgtgtgtactttgactgcatggtccatcctttcgagtgctcctgccgatttcaatttgcaaacttataacgaatattcgcattcgtcaggttttccaatccgatggttccttcgttggcaaattcggttcctgcggccgtggcgagggacaacttgagcatccgcattatatagccgtatcgaacacgaatcgtgtgattgtttccgattcgaataaccacaggattcaggtgagccaatagcccccggttgccactggtcccttgggcttttccatgcctgtctggccatgtgaacaattttaattaaaatatgctcaccatcgagattcattcccaatttatttgaacttcctgcaccttccgtgcctgtcacctctttccgtatccgtatccgcagattttcgacgtaaacggcaaggtcctctccacggtgggcggcgagggttccgacgatggccagttcaagtttccacggtaagcaaatcgaatcacccattttaattgacaaagtattgaggtcacacttctgttttttatttcccgcacagcggtgtggccgtggacgatcagggctacatattcgtggccgattctggcaataaccgcattcagatcttcaatccggatggcagtttcctgaagaccttcggttcctggggctc

PCR verification status

Line verified as correct.

No slide loaded.