Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT19023 chr2R 14903242–14905440 (2198 bp) 5-HT1B, tn activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn02631165-HT1B6588bp upstream BDGP FlyBase iFly
FBgn0265356tn6794bp downstream BDGP FlyBase
FBgn0263083CG4335114272bp upstream BDGP FlyBase
FBgn0034413CG1511519755bp upstream BDGP FlyBase
FBgn0263473snoRNA:abba-a20896bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgatttctgagtgggatttggttgccactctgcgctttttaagcatgtgtgagttcgggggttgggccaagctcagcccttcaagtttggtcaacatgtgccagattcttccactcactgccttccatttaaagctatcgcgactatactagtcttggcagcgaaaactgtttacttgttactcttgttagccgactacgttggccattagtcacttcattaacatggcaagcagtcgctgaatgaagagataaatgcagcgagcagcccaggaacgtgccaaaaattaacaaaacccagaaaattgacaaaacacaagagcaagcggaacaaaaataaacacagctacacgttaagaaatgcataatgtatttagcttcaggaataaatgcaataggtaacgataaatatttaactcacagttttgttctactaaatatccaataataactttatttcaaggtaacaaaaatataaatagatccgtgcattttttttttgtgtgcacccattcaagagaactattgtgcccagaaggtttagcacgcgctgaattttaatttcacactttcgcactgcaatcaaagggaattagccgccatacagctggcgcccaaaaaacacagcaaaccactcacagcgcacaccacccatcgcccaccaccgcccactgctttcgagtgggcggtaggtgtcaactttgccttgcatgccatggacggtctgccacgcccactggaaaggaggcgctcgtgctggcactgctgttgactgttattagcgcactttgatttgtatttggctaacaataaaatgacagcttgcggctaaatggcacgcaacgcccagccagaaaatcgaaaatggtatgggaaaatgggtgggtcccgctttctggacacaacctggccggaaatgccaacgaagttttggagttagctggcgtgcgcctgcctttggtttacttttcattccattccgattgccctggccagaggcaaaagtcagctaacaagtctccgctgcacgccataaattgcaataaacgagcgcaggtgcattgcattggctaactggctggttgcggtggagcagaaatatgataaccgctaattaacgtcaaacggatgtggatgcgaaaagtcatgccaagaaaatatgaaacttgtgttctttaataatgaacaagaaagtctaaactaaattgaatggtcgtgttaaaacatacatatttgaagaacgtatttttttaaatttaattgaactgaaaacgtaagattatctacttgtgtcttaatcaaacataaagcatagtattattatatcaaatcttattgtttataagtttttcaacctaggcaaattaatctagtcagattcttgattctgtttacttgcagtgtacataagaagataaatgagcaagggaagttaatgggaaaagagttcattataatgagcgaaactggttacagtcgctgcccaaaatgaacgtgacagtccgagtctaccggcaaatgtaaccccagagtttccatcaccccacttggctgataagattggaaaaactctacagtccacgctgcgtatacgtgatacgggtataagagctcgcgtataagagagataggaccacacatttcaatctctatggagtaaacagaaaaaacagccatttggctaaaacgcattgagtactcctctgcgtgtagacttttaaaggtaaaaaggcgaatcgaggacgaagccgagacagccgatgaatggcgaaacgaaagcgaaaacgaatctgaaacttaaacaaacacgcaagcggcacacaacaaaggcagagaggtgcgaaaaaggcgtggtatgatgtcggtggcggcccagagacatgcaaggaccacaaggactaaacacattgtaccaccagataagtgttctagccattacttaccagattgcaaggagtggcattggtgacatgaattttgatttctaggtgtcaacgctgattcgaaaatgaattattgcgataaatgataaacgagttaggaataatttttggtaattttgaaaaaatttgaactagctttgaaataggatatgaaatatatgataggaatatacattttatttgcaattgcgacttaatatttataatataactttctataatgaaacgaaggtgtataaaaagtagaaaattgtgtc

PCR verification status

Line verified as correct.

No slide loaded.