Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT19074 chr2R 14996928–14999087 (2159 bp) 5-HT1A, CG15117 activityactivityactivityactivityactivityactivity
weak
ventral nerve cord anlage subset, ventral nerve cord primordium subset, ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10ventral nerve cord anlage subset1
11-12ventral nerve cord primordium subset1
13-14ventral nerve cord subset1
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn00041685-HT1Aoverlapping BDGP FlyBase iFly
FBgn0034417CG1511712808bp upstream BDGP FlyBase
FBgn0050125Ir56a13250bp downstream BDGP FlyBase
FBgn0027535botv20166bp upstream BDGP FlyBase
FBgn0034418CG1511824304bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tggccattgcaattatcctctcgatggaagcaaaccgcgcccatttaggccacaatttcgacaaacccaaaggggtcagtcaaaggccaaaccgcaggcagcattccgaaatttctgtgcacatgtcttggggcatgaccctatgaaattatgctgtccaattcaaatatgcatagcatactgcggcgaaaccccaaggaaatgggggctgtaattaggcaggaatcatcccgagttatgaaatatgcattgcaaaggttttttttctatgctcagtgggtaggaaaagctaagaaatcaggggaaggcagggcttaagttaagcatacgccacgtggacattaaagccttcttggccgaaagttgagcgataagtggcatcttgtcctgactggcgaatgtgtgagagtggtttggccagaactttctaccctaatgcgccagctggtcaaactaatacgcacaggatgtgctcaagtccagtctggccaaattgtaattttgttttcgcttcgagaagaaagaattttcaacaagttccgagttgcttatcaacgaaattaaaaactaattttcgttgcaaagaatcttccgcttgactttgcttaacttttaacgcacgatagtgtatctagagtttggtcttcacttttttgccctctaactgactttttcgccaggacattttatttatttttttcttcaatcttgacctgctggcaagctgctacttagcttaagcttagtgcttactaaattgaaaatgaccatttgacgtaaaaatgtttgcaaccacttacaaacacatgcgcttttacatacagctgcggtcatagaaatagtagctagtatctagcctattcaatggaactgagccttcatatgcctataactctgaggacttgacttacacaatggaatggtatcttttaaacatatgattctgcattacacattgattacaattgtatgtatgtaaaacgctgattaggtgaaataagcaggcacctttctcactattattttgaccgcatctgtgcgaagccacgtgtgtgcatatcacactgactagagcgaaaagtcattggaatcacaaattcaatgcgcaaacaaggcaagttgtccactatttgccatccgtacacatgtcctgcccgacgtcctgccccccgatgttctgctcagccagctatatatgcctgctcccatgtcctccgatgatgtccggcccaatctagctggcctcacatgcgtgctttagttacatgtcaacacacttacccgcacacccacagtacacacagcaccgtggacaggacacacacccacatccatttagtgccactcactagtcggtcctggttcgggttcggttcccacagagcagcttgttgattttagaatatatttacccggcacacacacacacacacatctgatatatcccttacacccgttgtgttgaccatgcgatcgaattgaaaagatttcccggcactctcggaagtttggaggcgcaggaaagggcattagacctgcgacttgttgtttattggtcttatttgtccgttctttaataactaaatgctttcaaatcgcaaattgcttttctccacgttgacaagggtataccaaaaatcgctgcgttcattttgtcgaccatttttgtgggtaaaaagggtattggccagtataaatttcaatctaattgcctttgcattcggtatgtttattggcaaattgttaaataattcgatggcacaaagctgcctaatcgaattcacatatgtatatgtaacaatcattggacaaaactaatttttcgccaaaacacgatgtttgtatttttaattaaaatgtaattttcatgccggtcacacgcacattgattttccaattaactgatggccaaacagcaattaagccaaacaggtattatccttaatttagctattggcattatgttcggtccaacggccggcaaatgctatttataatccagcaaaacgaagtgaaccaaatgccccagggcaatataccatcattacaatcacatttgcaagaacatctcgaattgattgctccagatattgacactattttcatagccaaacatgtgacagaacagtcgaggccttgagttcgcatgagtgaaaagca

PCR verification status

Line verified as correct.

No slide loaded.