Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT19579 chr2R 15995024–15997167 (2143 bp) 18w, CR44633 activityactivityactivityactivityactivityactivity
weak
brain primordium subset, ventral nerve cord primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12brain primordium subset1
11-12ventral nerve cord primordium subset1
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn000436418w3992bp upstream BDGP FlyBase iFly
FBgn0265844CR4463316225bp downstream BDGP FlyBase
FBgn0265843CR4463220825bp downstream BDGP FlyBase
FBgn0265845CR4463429426bp upstream BDGP FlyBase
FBgn0265846CR4463529826bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcaaatcgctgtggtctgtgctttttttgttttcgtggaatgcttttcaggtagccaaaaatccggccataagttttcggtcagcctctaagcgagagacacatggcccgcgaacataaatcaaaccgaccaataaatacttgcggccgggactcgagattctacatagccacagagcagtaaacgcgtaattaaccccattctccgcgaaggagcagagaaatatggcacaagagttaatgcacattaaagctcatatatcaacccctacacaaatcaagggggctgagagttggggccacaataggcagcctttgcaagagcctcaaatgctggcaagccactcgagtcggcgaagctagcacaatgcagcaaaagtatctttaagatgcacttgagcggtcgtcggcatctctcctctcgttactcatagcatatatatatatatgtgttcctccaccgatgggtttatatattttataaaatatcgcatgtcatataaaaatgcctggcattgtttcagcatcgacgtgtgggcgcattactgagcccgcatatcaaatgagtcctgagttcgagacagaacacaaaaacaacggcagcaatagcaaatcacactatcgaacaagaatttttaagatagagaaataccaagcagacattatagctgatggggatcttaagatatgtggcttgagataaaatcaatgttttgtctgaaataaattagtcaaaaaaatttcccttttgggagagtttgaagtgaattaataactaaataaaatcattattggaatttatataactcaaagatcgtacagtttttatcttttctaaatctccacagtttgttatcttagcaatggtaataatgttcgatttgttgttcagtttaaccgatgcggaggcggcaataatgtaatgcaagtgcgcctgacagctgccaccaggatgactccttcgatggggatttccattgctgtcacacacactttccactccagcagtgcaacgcggcacacatccattgatggccttcttattcccgggttcattcattaaagcgccagcaatgatattcataactgccttttcaactgccatggcaattttcaatcgcatccaaaagattatgaaaattttggcctcaaaaaatcgggcaaaacgctcgccgcgttcgcattcggtattcggatttcggattcgcaacagcagcagcgcagcaaaatggaaaataactgaaatcacaaaacaaacttagtgcgcaaacataaattatgcattacaaacgtgcttctgacccattgccattttctaattcaattaaaatggtttttgtttctccagttgctgctgcagttcgctgagccaagcctaagcatttgaatacgatttcccaaggagcggagcgggaaagtttctgaataggccgctgggaaagttggagcatcgcatccaggcagccagacactaatttgacatagttatgcgagtcgaaatgaaagctgcaatgaggattttggccgtggccaacgcggcgtatgaataatatttaagctgtggtagttgccgctgcaacaaacaaacattaggccacttttatggaaacctcctgtaagacacttttggccaagcaggtacttgaaattcccataatgtccaaagaatgctagtaaacttttcactaggcgaaattttgaagagttaaccaaccgaaaaaagcctcatttttgaaccatttttaatctggtttcaagctgtacaaaaactgccactatagttatgtcggcttgagtctgcccgaagaaacagaaaaggtcgacgacacacatatgacaaactctgccgcaaagttgctggcacatgtcgagttaatgaaatttaaaaattcataaaatattcgcaccactaggcaaacagcagtaagaaccacgacggcaacatctacaatcccaacagcagcagcaactgcaaaggggaagtgtaactcaattaattaataacaatataccagcagcagcagcggcagcagcaccagaaacattaacaagaacaacaaacaaaataattaagtaacaaaagtttcatatttgcaacgccacaaaaacaaagcgggacagaaacgcagcagcaacaggaggaac

PCR verification status

Line verified as correct.

No slide loaded.