Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT1971 chr2L 3828414–3830695 (2281 bp) slp1, slp2 activityactivityactivityactivityactivityactivity
active
procephalic ectoderm AISN, anterior, procephalic ectoderm anlage VDRC

Annotations

stageannotation termintensity
4-6procephalic ectoderm AISN4
4-6anterior4
7-8procephalic ectoderm anlage3
9-10ventral nerve cord anlage subset2
11-12brain primordium subset2
11-12ventral nerve cord primordium subset3
11-12ventral nerve cord primordium glia3
13-14ventral nerve cord subset3
13-14brain subset3
13-14brain glia3
13-14ventral nerve cord glia3
15-16ventral nerve cord subset3
15-16brain subset3
15-16peripheral nervous system3
15-16brain glia3
15-16ventral nerve cord glia3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0003430slp11316bp downstream BDGP FlyBase iFly
FBgn0004567slp28426bp upstream BDGP FlyBase iFly
FBgn0264886CR440779881bp downstream BDGP FlyBase
FBgn0264885CR4407612467bp downstream BDGP FlyBase
FBgn0031573CG340715005bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ctcccccatacatacatatcgcccctttttatctccggcgagaagcgatcggtagcaattatcatattttgtgtgcccatttttcttcgattcaataattgtaaattattgtgtgtgtgtgtgttggtaaatcatgttattgaagcgattagctggcagttttataaggtgtcagttagaaattggggatgcttaagcggcggaaaaggttttggggatcggttggttgggttggtagttgtgcaataaatcagttaacaggttggggttacctcatctttttgtaatgaaatgcttagctatgattattcatatgttttataatagttggaaattgagattgttttgttattgtaggcttcattgttcagaaaatctcagtacacatatttctgctcattttagcagctcccaaagaagcacttttcttatagaaaacattctcccattccatagcttgtatatatatatttggggtttatgctcggcttagaccagtgcaagagttaaatcggttttggcccacgccttaagccatcgattcaaatattttgcatatccatatatacttatgtccatatacatatctgttttgctcaatccgcagatcaggcgaatagaacaatttgctggccgcattgttttattgcgctgcccggcttaagttggcctggtttgttattgaaatagatcggatgagcgcattatatacttaacacatctcatgtgccctggattcggattgaatttagaaatccacttacctaagcccgggactagctctaagctctaagtcgctaaatcagtccgagggtctcgggatttcttaaactacatatcactttagaatagaattggttgggtataccgaataaccgaatggtaatagtgaatagtgaatagcgagtagcacgcgctcgaccaaaagggaaatggatgtgaaattgaaaatttcttagccaagtctgctttctattggcttaagtgctcgacatgcaatttacaaagataacaagcagaagcaaagcgaaacctcggatctgccttacttatcttattacccgggttaagtgcagggattacgatgtcgaaagagcaaccttgtgggtccttgcgggtccttgtggtcctctgaatatatagtatacagtgtgcagaagggctcaaccagcagatgccgagcactgattacccagcatgcgtgctcgcatccttcggatcctggcatatagatcatacatagtagccaggatgcgtgtgccgtttgttacactttttgtccatttagactgctcctgggtgctccttcccagctctaatgattcaaacccatcggcttaattcctggccgggtctatttcataaatattttatatataatcggctagtttctcagccgctttgtttgtgcaaaggcttaagatcaccagtggttttttcgatcggttttagggctacaaggattgtatacttttgaagttcaatagagcagttactatggataggagttgtcttgaaaatatttctttgtaaggtgtctaactgattgcaaaggtgtggaaaatggtttcaggatcaggtatctgatattttgtgtaatattactatagttgttatatatgtatggtaaagtatacaaattgttcacccaaattgcgtaattggatcagttgaaactatcgatgagaacctcaacatctgctaacccactttgttgacagttagcagtttggaccagcagccaagttgccaagcaaaaatattgacattatcgattggttttaaaatccaccacatgggtgcaccactagtcttgtatactaatgcccacatcagcagaaacggaatcaaagaaacacatacagaagcccctcaagaattgggtgtgtcatctaggagtaatgcaaactgaactatgtagaaaccgagcttaagtcgagcccaacccatggagaaccaaaccaagtggcgaccacacagtgaccacaaaatgtgtttttaattgaaactgatgtggctctggccagtaggcagtataaaagtctgatgggttcagatgagggcagggcattcaaatatttattaatacaataattgttaacccatgggtcgcgagtgctcgctcaataatcaaataatggcaatacaaatacagcgaatgggaaaatatttgaaaatatttgagcgacaaatgcgcaaagtaacgaacacacatgtgggcagtttggtggtgctccttaattagtttctttcattatcttggcctctctgttgacccgaat

PCR verification status

Line verified as correct.

No slide loaded.