Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT21420 chr2R 19457556–19459654 (2098 bp) apt, CG30184 activityactivityactivityactivityactivityactivity
active
dorsal vessel, brain anlage subset, brain primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10brain anlage subset3
11-12brain primordium subset3
11-12visceral muscle primordium subset2
11-12cardiac mesoderm primordium3
13-14ventral nerve cord subset2
13-14dorsal vessel4
13-14brain subset2
13-14visceral muscle subset2
15-16ventral nerve cord subset1
15-16dorsal vessel4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0015903aptoverlapping BDGP FlyBase iFly
FBgn0050184CG301845254bp downstream BDGP FlyBase
FBgn0015277Pi3K59F5989bp downstream BDGP FlyBase iFly
FBgn0034880ItgalphaPS59771bp downstream BDGP FlyBase
FBgn0034879Rrp413817bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ctctctgtcgctccgctgggttcttggtttgcgcgtgtatttgctgcctttataaacatgttttcgcattaataatacatttttattcgctaatttaaatgttgtttacatttaacaaaaaaccagttagagtctgcgacatatcagcacatatataatcgcaaacaccagcggtcacaacgatgtagctcgactaaactaaaccatacttatatatatctcattaatacttttgattttgcaatctcagctaaatgatgatgttactgtatatatgaaatccccaatgattcaataccactaatatgttgaccgcaaacgtacatgagtgtagtacatatagaaacacacatacagcagcacttctgggtggagcctaaactttgataatttacttagtctgggcatgtttttgtgtgtgtgtgcttctttcttattcgttatttatgcatttgttaaacttagacttgggaatcattcgatggcgacttaagacttactctgtttccaaaacgctccccatggaccagatacccatgcttttcacttcacagcagctagaccaacaattgttgaatttgctgagaggaaagggttgctggaagtggctgtgtcgctttgtgggcgattaaaccacccacaatcaacgccttgagcagcgggcccatccactttgcctccccttttgtttgaagatatccttgtcaacgcattaaataaatgttgtcgcacccccaaaactggctgatcaaatcctcaccagcttttttccaactcaaaatgttaaacaatgtggttaccttaatgtatattaacattttttttttgcatctgcttgaatttgagtggtctaaatagacatgcaagtcctagaatttgtttcgaaactcagttccggaaccctttggttcgtatcctatctgcgttgaattgagtggttttatctcgacaattggtaaatggcatatgagtgttccataatttccattaattgaggccttctaacttgatcaagcactagactcggcttccatccactccattcagaaagggtcgcacttgggtttatggccggactgagataggggatttcgtttggaaaccgaaaacgccgtcccagattcagattcggttgacaatggagcggaactcgaagccgtgcgtcaatttggggcagcattgaggatgggtgattgaaacgcgacaatttgtttggttctcaagtgcaaatgctcgaggagcgagcacaacttgaataacaagcaatgagcaatccggccatcggcaatcgtcaatcgaagggggaacgtatcgcacacattacaccaatcaatccgaatcggatccagctgcccctgcctcgaattcaagtaaacaaaagccattagcaaatgtgtatccgaaagatgcacaaacggcgacacttgagctggtgtaatcaaatcataaattcatatatatatatacacaaatggagatagatacgggaatatgctcgccctgtgtcattctatgcatttccattagagtcgcacaaatatacatagagtagatggatatatgtagatatagttatagatatacatatcccttccagtccgacgacgctttcgtaattggttcaagtgtctttggtctttgggctgcaaccacagaatcacagcaatgaaacacagaaactgtactttatcgccaacaacaatgagttgtcgaatcccaaaaaaccagctggttgttacgaacggaaactccttacccatcctttccctttcctcaccaacctccagctcatctccgctcatctccttcttgcgctccaggacttatcaaactatcttcgagcgttttgctgcaaccccttcgcatcttcctgtcgtccctgctgccatctcacctagctgagttcagctccgcctgtccgtcgagacttttcttattgtctataccctaaccattagtttccaactgggagtagcagttgatgatgtccttaggactggtatctgccactatcttacgatttctaatgtgcaaaatgaaatgcttcatgtcttttggttaacaacttttcaaaaaaaggggtgttcatcgagtaaggc

PCR verification status

Line verified as correct.

No slide loaded.