Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT21450 chr2R 19505812–19507977 (2165 bp) CG17664, CG4019 activityactivityactivityactivityactivityactivity
active
head subset, anterior hindgut, ventral epidermis anlage subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10ventral epidermis anlage subset3
9-10hindgut anlage3
11-12head subset3
11-12ventral epidermis primordium subset3
11-12hindgut proper primordium3
13-14anterior hindgut3
13-14hypopharynx3
15-16head subset4
15-16ventral epidermis subset3
15-16hindgut2
15-16head epidermis subset3
15-16anterior hindgut4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0034883CG176641536bp downstream BDGP FlyBase
FBgn0034885CG40193580bp downstream BDGP FlyBase
FBgn0034884CG1766211636bp downstream BDGP FlyBase
FBgn0004795retn14321bp upstream BDGP FlyBase
FBgn0034882CG539814649bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgtgatatatgaaccccagtggtggaagtagctactggggtgggttgtttttttagggatcataaataataataatacctccgtttctaattataaaattcttagattggatatataccaaatataaccaaatggtaagcgattaaaaagaaatgaggcattatgtttttatataaatgaatatgcagtatatttacatatatcttaattacttcagccataatttgatagcaactgtatgtagtgcttagaactttttaaataaattaaacattagcattagtatccgctccattttctattattttcaagcagcgccgtgtggacattaacttgacgtattcgagagatcaaaaataaccgactcacggcgattaacaggaattaacatgtatcgctaaagtcggccaaatattgacaatcggccgaggcgagtgagtgacggagatcggatgtatccggtccagcgatgagaagcaggattggaaggaggaggagcaggaggtgctggtggtgctggaggccctggaactggttaatgtgagtacgtatacgtataatcgatttcacactactttttaatcactacaaaacatttattgtttgcccgcagcgagaaaagtcaaacaaaaagcggcgacgagtcggaatgggtcgaatggctgaacaaattgactcggccacataattaggcacttgcccatgtccacagcttgtacgatatatccatacacatttgtatttgtacatatacatatgtatatcccttcgattccgtgcagttgaaagtatctcacgcagtgggacaaaaggtttttattgtgcgtacccgttgacagcctcaatcgacggggtttggtcgaaacttaccttttgggtcgcatcgtttgttatatttgttatttattttgcggttataatacttatgcactggccgggacggaaaaatattggcatccattcagcgggacaaaacatcacggcgtttttacagtttctcgagccgcgaccggatgataaattagctttgtacgtaaattcaaaatggaaaatcagtatgtgaaaatatccccagctcgagtcgagtcgagtaattgtgtaaatatcttgtcgctgcatgacaataccagacatccccattccgcctttctttgccgcacaatgaatgccacattattattttgtagtttgtcaaccaagccgagtcgaacccaaccccgaaaaaggcgtttttcgagacgggtgatgagatgggagatgggagatgggagatgagagatgataattcaatgtcgctcggccagcgcacggatgcagatacaatatctttttatacacatgatgaccgcgcaggccaaaggaattgtaattacgtgtccgtcgccttgtgccgcatttgtatcttcatttgtatctgtatctgcattgcgagtatctgtatctctgtatctccaacaaaggcatcagcataacaatgcacccatttctgtaagctccggatctgaacttctccccctcccccctccacccagcaacgcgctgtttcgcttaataagcgcctaaatagtgtcaatgattaattgcttttgtgattagatggaaatttaatagattttttattgtctgcccgggcaaattgaaattctatcaaggtacaaacacaaatgctggaggcacgtctgctcgtttttgtctctgcaacggcatcgttattaccctcctcacagcttcagttcagttatttgtcaggcgggcaaaagagccgcatcattgttaccaatttcgaattcaaattgaaattcacacgcgtcacgctgcccgaaccaaaaaaatgtgccacaaacgcttgatctgctccctgtttgttagctttcctcaacttgttagctttccgggcagagaacacatagcacatggcacagaccacagacccaaccccacgaattcctcttatattaaatgtaatgccaccgcaaaaatccccaaagccggccgagcgaccacaggcaaacggaaatagatacggagaagtcctgcgactagcaatctgctcaaatcccacacaaagtcgcaaaggaaacacacacattgaaaggggaaattcaagtggaaattactcaattacaaggcgcgtcccctgcgcagcaattcttcagtcagttctcg

PCR verification status

Line verified as correct.

No slide loaded.