Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT22068 chr2R 20695143–20697250 (2107 bp) CG42851, Dll activityactivityactivityactivityactivityactivity
active
dorsal ectoderm AISN subset, A-P semi-stripe dorsal, procephalic ectoderm AISN VDRC

Annotations

stageannotation termintensity
4-6dorsal ectoderm AISN subset5
4-6procephalic ectoderm AISN3
4-6A-P semi-stripe dorsal5
7-8procephalic ectoderm anlage3
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0262098CG428511705bp upstream BDGP FlyBase
FBgn0000157Dll7202bp upstream BDGP FlyBase iFly
FBgn0035069CG36117638bp downstream BDGP FlyBase
FBgn0035068CG128499008bp downstream BDGP FlyBase
FBgn0023181Orc410207bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

atgaatggaagaaagccagcccagtttgctgttttccatgctaaacagaagctgttctactgcagcagcagtggcggcgtcaggtgaacgcggacgtggatggggatgtggctgtttgtggtggatgttgtacgtaaacgcgcccactcggttactccgatcggctgcaaaaagcgctccaaacagctaagacaaaagtaggagtccagccatggagtgccgaagttcttactactctctatcgacatagttcgaagcccataatctgccaaattgaaaattcagaagattaaacaatcaaagaaatatatattgcaaccatatttgtgtatttcggttatattgtacacgcttctcataaaaaggcatatacctcggtttcagggtatcaaaataactggcttaaaaaaagctaaaaaaaaaaggtcctaccccgtggcgttttggcttttgatgggttggctctgctgactgctcggcagcggcaacatgcggcatgcagcaacagcatcagcaacggcaacatggggcagcagcaacatagtttacacacctaccgatgccgcagtcgaaatgaagtcggagaagaagtcgggggctgggctccgtctgccgaaccctctggccagcaacatgcacttaactggtagccacaatgcactttataatacccgggaacatggctctcatctgtggcgcggagtgggtatctgcccctcctcgcagtttgatagatgcggctgactcggactcccggagcgatctaccagggggcgttgctgctgtgctgcagtgcaacattggaggacagagtcgcagttgaagcagccgagtaggagagtagcatagcagcagaagctgcaccgttagctggcttggcttgtgagcttgggcctcatttgcatcgggccataaactcggtggcccagttctcgacgggcgaacccgtatccgaatctgcatccgactgcgagtgcgaatccgattgcgagcccaattgagacgaactttgagccggcgctaggcaatggccttggattagttaaatccgttccgttgcgacccgcctaatccttccttcctgcagggcacctcattagccacaccaccacccacccaggtaggggtaaggtcaagggtttccgggctaagggctcggaaggtgttttcgccgtgtaccaaaatataattagcgagccgggcaaatctctttttaatgccgtccagtcagcgggggtgttccgattgaaattggagcgtagccgaaggaagtgtgaaaagtcgatgcagaatttccgaaaactgagcccaggacgctgaagctgaggtagacgaggccgggaattaaaagcgcagccgcctctcatcatcatcagcatcatccttagcaacgtccgcaaaacactcacgcacacagggaattaagttgagttctgggttctggatactggattctggattctgggcaccgaggttccagttctgagctctaagttcccagtttcaagacatgaaagatgccgaccgatgccgaggattttcgatgtggcgccggccagtgagtataaatcatatcactcacacacaaaaggcgtgggaaggggtaagctggtatacagtcccgcgaccgcagtctttgttaattaattgcccagctccagaatagacaccttttcaggcttcgaattttttgagccccgaagtcacagcaaactttgcatttttcggaggcggaaccaaattcaacaacatatttgatagatttcagaaaacctacgattcataggtttcaaggggccttgcagatccatgtggcttctcttgctcctgctgggtctgccgatggaaacaaacgaaggagaggagtgcagaaatggactaactctcggacgccagcagtgctacctccacgaggagatctttctagcccaccaccctttgcaaagtgtcacagccaagaggctcaagcttccctggtggtgcgccctcctagaaagcctcttcctgctcctgctggtgaagctgctccagttgtagatgagccaacatctctctctctttctctctctctccgtaattgccgctgatgtaagcggacaggtggaggc

PCR verification status

Line verified as correct.

No slide loaded.