Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT23557 chr3L 549321–551551 (2230 bp) hipk, Cypl activityactivityactivityactivityactivityactivity
active
pharynx, anal pad, lateral epidermis broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14anal pad3
13-14lateral epidermis broad2
13-14dorsal epidermis broad2
15-16pharynx4
15-16hindgut2
15-16head epidermis subset3
15-16anal pad4
15-16lateral epidermis broad4
15-16dorsal epidermis broad4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0035142hipkoverlapping BDGP FlyBase iFly
FBgn0035141Cypl6391bp downstream BDGP FlyBase
FBgn0035140CG171807175bp downstream BDGP FlyBase
FBgn0001316klar8708bp downstream BDGP FlyBase iFly
FBgn0085298CG3426920326bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

atctcgaaaatgtacggggtacgggtatagccaaaaatattagtttttgcgatatgaacatgttgattttgtgtgtggcacttgattttctggctgtcatcggttagatatttgtttatttccacactcttatcgtttgttatgaatttctgacaaaaaaaagtttttggggataattgtttcagctaattctgatacctcaaagcatataaagtttatacgccttgcctatcaagtaggtgaaaatgtccgtagatttcagttcagctttcttctcgtgtcttttcattctgccctaattaacttctcgctcagcattctcgacttcatctgcggtttttcacatacatacacatttctggtttttttctctgcctgtcgatcagcggcatcaaaaagtttccgcttactttgttgccttttcattactgatagccagctgcacgtatactttcgcccataaatctccgccggttgctaataatttcagccgactgtgagccctaaccccgcagaagatttcgccacggatcacgttggttttgagtgggtgaaaggagctcaggcagctgtgcacccagcccagtcttcctcgggtccaggtctcctatgtcccccgtttcgcctcttctctataacccgcttttacccctttctacgtctgcctgtgtaggcgttctttttctttgcaatttcacccggctcacacagatacacaccaacacatgcccataaccggtgcgccttgtctgctctccttctcctgcatttgactttatgcggggtatctctgttttctgcttgaggatgttacagcttttaaatctttattcgaatatttaacaattgttttatctttatctgattgataatcagattaaagtaagtattaagagagaattgtacattctcttataatgaagatttagtatggaacttctaaagcttaaagaaaaacctcttcacaagggtatttaatacaacttgttattaaatctttgtctactgctcttatctgctccccttcttcttgttttgggcatctttaataacgagaatctttcactttgcctcgttgtttctgctgcagcctgacaccgttattctatactctagagatggcaacgtgagtgtctgtgtgatgagtcaatgtggggtaatcacaattaaacaatattcgtttatggaaaaccagatgcacccggttctcgaagttacctggattgggctgagacctcactgggaacaggttccaccgtctgggttcccgaaaacaaacaggttccacatgtcgaacgtgtccaaaatggattcccaaagggaaattggtacacgcgtgcatctctcattaagactcagacggctccctattctccgcccgcctttcttctccttctcctccattcttttgggcccctttctccgcttctctagctacttgctacttggttatgtgatacattaatggcgtttgtgtgtgcgtgcctctcggtgttcccttttgcgacacacaaaataaagccaaaagcagcaaaggtttcttcaaaagcattctaccaagcccacgcactacagaagccccagagagcgaaagagagggaaatacgtcggtgagcgagacggggcacgggtgggcaagctcacatgtcaatcagtccctttctgacacgttctacaatacgttgtttctgctgacgagagaagttcaatttagttttaaataaatatttcatatttttcccagctcatgattcccttcaaatccattagagcttaaaaattaaactgtgcttgtatgtacaattattattattattattatgacaattattcattaaattatgtacttgtagtgtatttattttgtgattttaaaataccctttaaattcctgatactgatacaagtttttaatttaagcaaatgttgagtaatttgcaatgatattattgttgatttggtttttatttttggcccgaccgaaaatatatttggctgctcggttgacatgtgaggaaaagacgagaagcagacccaaagagacatgcgaacgagaaatgtaaatgaaatttccatgcaagacatcacgtaggctcaaagtgcagatacaacgaaaaccgaaagacgggtaaacaaaatttagatttggtttcggaatggttaaatgagccaacgactccgacccgctgcaaattcatgaatatactcgtattcatggctctctggggtga

PCR verification status

Line verified as correct.

No slide loaded.