Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT23951 chr3L 1322658–1324778 (2120 bp) Myo61F, CG9184 activityactivityactivityactivityactivityactivity
active
trunk epidermis broad, lateral epidermis primordium subset, head epidermis ventral subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12lateral epidermis primordium subset3
13-14head epidermis ventral subset3
13-14trunk epidermis broad5
15-16trunk epidermis broad3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0010246Myo61Foverlapping BDGP FlyBase iFly
FBgn0035208CG9184overlapping BDGP FlyBase
FBgn0035207CG91534329bp downstream BDGP FlyBase
FBgn0011361mtacp17291bp upstream BDGP FlyBase
FBgn0035209msd19086bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccttctcctggaaacagaggccgctgaccagcagctgcaggataactgaaaaggatgtgtcactctttctaggcagccgatcgtccgtactcacccaaaccaatcgcagtcactctccgatccatgatctctctcggaataacctgaccactccagttgcattgcccttttatacgcggtgcatctgtgatgagatgtgtgggatctcgttcccggtttcctcattagaataacccatgcagtggcccaaatttgggatgcctttctttcttctgtgtccatctccatctccatccccagctccagctccagctcgaactcgatctcgatctcggatcgatcaagcaccgttctaataactgcgctcattaatttgcatatgatataaatgcttgtaggggctttgtgggatctttccacttctcattccacttccatgatcgttctgccagccctgcatttttccaaatgaattcgaagagttcaatatcccgcgatattgctgcttgatatatgacgacatttgaatgcagatgaaggttggtcatgccactgaacaaaaaaatattcagcaaagctcttgagttggcaacaaattttttggaaatatgtgcccttgaacttattgtattatcgttgagtttccgtctttagaacttatctttactttttacgaatgtatttctccatctcgctacaaagcaaatcagcctctgcctcttggtttcctattcttaatgctcgactatttctttcggtgtgcgattaatgggttaggaactttttcgtttgggtgggactcatggtttttgggttccgttataggtcgtgtgtcgtagacatgtttacgagtcgtctgatacaacaaaatgtggagttctctgttacatcacccgttggagtatttctggatcgggaaaccagttccccactctattagaccgctgaatggggattaaagaaagagtggatcaagccgacaaaagcaacgcccccagggaacagaaagtcaatgacttcatagtagggagaaaccgtgttattgcagggatattgagcaaagtataattataatgactacacactcattaatatttacagtttaattcattttatatcccccagctagtttatctaatcatgaaagtatctgtagaggcttgccccgccacccagtcaactttggcaactctcttatcatacaacatatactcgtgtcaattggatcccaaacagttccatgagatctgcactcacctgccctccaacttgtggattccttaaatagacgtagcataatcttaggcgatggttggtttgtcaaaagtgctaaagtgattgcagaatgactgcaaatggctgtgcccattgggtgatgtattcgtatatggttttcgacatgatcgatatccacttccatctgccctacgtgcaattaaacaattatgtgacaaacatcgaatcacggcgagctcggctccaacgactgggacgtgtctgccggtctcttcgagaattcctgggaagtcttcccggcaaacatttcgcaattagtcaggcattcgttccagttccacacagcaaatccccttccaagtggcgcagagtggatggaaacacacaatagtggcggtggaggcaattgcaatctagtgtgtgtacttacaatgttttcattcggcaatgacttattatttagcacactgatagctgataacacagtgctaatgtgagctggagcacttttctgagtcggggttgtgagtttcgagctctgactcactcagaaatgtcccgaaagcgcggcagtcatctagaaatcttgaaagcattaagttataatttacattttggagaagcaagtttatgaaattagctaattgtggagcaagaactaagtaaaggaattccttatgtacattgaaatcaaatccttgatcttcgcaataatggatactaaggactacatagagtaagcagtgctaagataaagaaagtgaatagattataaatcatatagaataattcttgattagttatctaaaaaccaagaaactggttcgcgtagctaggaggaaccacattatgaatcaactgaaaacattgggttgctcggaatga

PCR verification status

Line verified as correct.

No slide loaded.