Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT24633 chr3L 2729149–2731248 (2099 bp) Mrtf, Acp62F activityactivityactivityactivityactivityactivity
active
posterior endoderm AISN, posterior endoderm anlage, anterior endoderm AISN VDRC

Annotations

stageannotation termintensity
4-6posterior endoderm AISN3
4-6anterior endoderm AISN1
7-8posterior endoderm anlage2
9-10posterior endoderm anlage2
11-12posterior midgut primordium1
13-14not active0
15-16lateral epidermis subset1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052296Mrtfoverlapping BDGP FlyBase iFly
FBgn0020509Acp62F10601bp upstream BDGP FlyBase
FBgn0264606Fife17460bp downstream BDGP FlyBase
FBgn0035370CG124037850bp upstream BDGP FlyBase
FBgn0035371CG997739317bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcgatgctgacgacgaactgtggcccaggatggccgtctgctgctgatgttgctggagtgtatttgtattgctggcggcgagcttcgtgtcaatggttatgggtatgacactggtggccaccagctggtgatgcttctgctgggccagctggtgattgtgctgctgcggattctgcttgctggctgctcctcctgctcctcctcctccgccggctgagccctggaaccagctgggaaagttgcccttgagcgtgtcaattagatcctgatcgagcgttaaacgccacgatgcaggtccgccgtccacgctttgcgtcgactctgcaaattagaattagaaatttgaattttaaaggttcgaaaagttaaattgcttaatattgatgttatataaattgaaaataatatattttgtggctcataattataccattatcatttttacccaattgtcaaaaagcgcggcaaatgtacttattaaataattcaccataatcaaacttgtttgctaatgaaacagtaagctttttgatattttaaagacatcattaaatatttgccattgtcattcccgttcatcgttcatagctcacccacatttgatagttaaagccaacccaattcattaatttgcaatggcttaacactcggtgttaatttgattttccactttcctcatcggtcgctctctgtttttcctgcccacgctcacatttatttatttgaatgtggcttttccgatgatgttctgctgctgctgctgctgctgctgctgatgatgtggccactggtgtgctagttatttatgctaaacactgccaagtaacctagtttgttggcccaatccccagtccccacagccgcccccgcatagaaaacatagcaaagcgcgtacttggtatttatttttcaaattctttgctagtcgatgtgtgccttgggttttttggttctgcctgagattttgcggcactttttggcttgggaattgcccgagagatatacatagattataaatgtataattgcaatttgccgaatcactgggcgcactgctgcacttactcgtaactggtggcgacagtaatgcgaactggcgaactgcgagtggcgaaattgcgccgaaaatcttggcaagcggatgcattgcatcatgcgaaagcgacattcccagacacgcctcatattatgcaatattcggcgatatctggcgactatttagagccgatcggcggcgaaaatagctaccatcccagcataatggccaaaatctatcagctcttagccaactgacatgcacttgtcaaatgtccacctatttctggcacttatttttgtttccttttcctttgattgttatttctggttggcttaaaaaggttctcatacattgtcgccccccgaatttgggtatttttagagatctagtgaggatcacgactgttacgccgtctgtcccgatgactgtccagcctactgtcccgttgactgttcgttccgtcgaatgttacgacgatggtcccgccgactgttcgttcgactgttccgccgaattgtcgcatttaggtcgcctccaaatatcttttcttaacactgcgtgggcggagaatctgtcacacattctgctttctgccgccttgtttgtttatctgaactaaatttgaaattgctccgcaaataaatggataactgtgccgaccgctgcatttgcatgcgctgcgacatttattggtcattaagtcgagcgccagagcaaaagaaaaccagcaggaaaagcggcagccgctgcaacaggcaagcaaacaagcaaacaaaacaaacataccagtcatccaacagagcagcaacaacacattgcccagcagcaggatgcacagaaaacaattaaggaaactctttatcttatgcctaagtaaaagacaatctttcgagcgaacttttcaaaagaagttcgtagattagtgaaacatcaatattatgtttatattcaactaatatttctccccgtgtacctttgatgcatgccccaatgtggcgtttggttttctctgtgtgcgatggcgcgacatgatgtccacacgcagccacatgcttttgagat

PCR verification status

Line verified as correct.

No slide loaded.