Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT25720 chr3L 4801017–4803211 (2194 bp) CR44528, CG7509 activityactivityactivityactivityactivityactivity
weak
ventral nerve cord subset, brain subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14ventral nerve cord subset1
13-14brain subset1
15-16ventral nerve cord subset1
15-16brain subset1

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265721CR44528892bp upstream BDGP FlyBase
FBgn0035575CG75092060bp upstream BDGP FlyBase
FBgn0035574RhoGEF64C4765bp downstream BDGP FlyBase
FBgn0042131CG188085036bp upstream BDGP FlyBase
FBgn0261797Dhc64C6351bp upstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

caaacacaaattcaccacgaacgaaatttcacataggcgattcagaaaccttttactttacttaatattaatgcaagtttacatagagctttctaacagctacgtaattgttttatttgttttttgagcaatataagcaatattctacattaacttttatttcctaacgacatatttaccaatgaaatagcttctttttgaagcttcagcatccttttacttgttttgtttgaattcagaaataatttgatcattagtgagggtgagaaaggaactgcattatccaaattgaattttaagttttagtttttccaacttttccaaattgaccttctgttatccgacgaaaacacttaggcgacaattggtcattgactaggcaaaaggatctcgggtcctttggaatcctttaaaacgcctccataggcttgatacgacattccggcaagacaagacgctaagatgtttgcttagctggcaggagactttaaacttgagggaatttgcatacattaagggtgttttgttattttgttagcaaaaggcaattcaaatccttttacttccgctttaggcagcaacgactacggcaaaagacagatgcgactgatagcaggattcacattcgcaccaccgcccccttcggttttcctgaacccccgctccattagttttcccatccgtatttaacggtgacgcgtgcgttgcgtataaagaaaaatatgattacatattgttgtattttgaaaagccggcgtaaaggagtggaaaagggttgacatttttttttcgaggctatgtcaaaaagcggagccagccactcagaggcaatcagcttcgattgccccgaaagcacaggaaataatttcatatgcccctaagctatatagaaagtaagctatgtagaaattgtaattgcataattgcaaaagacgaacgaataatatttttcacgctcaaaatttttcacatttaatacaaggaattttcctcagtgcagacaactgccaaacaaatagccaacaacaagagccgaagcgacaacaaggccaacaatggcggcattcaatttttaatatttgccttgcaaattttgtataaaatgcatttgttgtctacaagcctccaggccgccatcccctggaattaccaggcccccgccccttaaaattggtgggcggaagaagaccggagaccgatgactggcggagggcacactatcgcccaataacacccggaacggggaagctccaaaagctggaaaactggcaactggcaacaggaagcagccagcgccgggccaaagtgggaaagtgaatggagcacggcaatgtcaacacatggaaattgcaaggacagcggcaaaaaaaaagagggaaaacagggaaaaccgaaaaggaaaacgaatagcagcagccacagtaactataaactggaatgatattgccaacgaacatactagaacggcactgaaaacaatttactcctttgaaataaacccatataattccaaactatcttcgtatctggtgcaaaagtatctaaaactccatcgggttaaagtacgcgagatgcagtgaaagctttcttgttaataaaatgttgttttcagtgcaggcaaatggcaaaagcgcagctagtgaacccagtaggacccaagatagctcctagaacgaagttaggctgggccgggcggaagcaataaattggttaggtaaaaagcttgtcgcaaacgcagacaccggtaaaaagcggcacgcgaggccgagacaggcccgtaatttttgcccaccaaaaaggcagaggaggaggaggagacggagtgaaatagaggtgcccaaggatggtttatttcccatgaggttgcaaattaatactaaatgtctgccatgcaaacacataattgactttaaatttgttttgacaagaagaagtggaaaactttgcaactttgatgggggtgggagaaactgcaagttttgtttccgacttagaaccaccaaaaggtttataattgttttaaaatagcccagaattccagaacgtaaaaacataattttaaatattctaaaataatttatttctattttctgcttatacggatataaggtgtataattctaatcctatgtcttcaaattgtccataaaagaactagttatgaaccttcttgatggacacgctggttatatcggc

PCR verification status

Line verified as correct.

No slide loaded.