Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT25925 chr3L 5224016–5226145 (2129 bp) shep, CG4669 activityactivityactivityactivityactivityactivity
active
anterior ventral nerve cord subset, ventral nerve cord anlage subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10ventral nerve cord anlage subset1
11-12not active0
13-14anterior ventral nerve cord subset2
15-16anterior ventral nerve cord subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052423shepoverlapping BDGP FlyBase
FBgn0035598CG46693567bp upstream BDGP FlyBase
FBgn0010747Srp54k76140bp downstream BDGP FlyBase
FBgn0263831Gen78541bp downstream BDGP FlyBase
FBgn0028962Aats-ala-m81065bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gagctgaaatccatttggcaacagctgcttctagcacatagacggctgaaaagcatacaaccttcgaggaactaacaatgtaagaggcatcagctttgtaaagtgtgtcataaaatcaggtctaaaactaacgaatcatatattaaataggcattttaagcagcagacaatgctgaacaatgcggcgtatacgcaatattgagtgtcaccccaggcattcgttcaagcagttttcgccacttaaatcggccagatgacgatgataataatgcaaccagaagcagcacagaaaaaaaaaaccatagaattctcctgtacttaagaacatgtatggccgaggaactcgacatatgccaagccgaggcagctggtggaggtggcattccaacaggaagggaattcaagccatgcccaccacttcacatagagttcgaccgactcaactttgacatttctctctctcactcggactgcctcgaattctgccgccctgctgttttttccccaacaccattccacccacggtcattttcctggcacacacaatggtatgtccacggcatgtggcagtcagatgtgtgggcgtggcgttcaacttgtttttgccgcaaaatgatttatgacaatgcattgaaaagttcgttctaggctgtcaacaagggaggggaaatgtcaataagggaacccagctagaccagaggcgatagaattgtaagaaggcaagtccttagaagcataaatgtacacagggaaaaatataaatatttcataaagataccatagagatccttgggctgggaaatgtgctcttatcaacacatttcgtgaccttttttttaagtgcgtttcaatctattaaattgatagccatctctgcttcgcagctaaccatttttatctgattttcaatttgcagctagaaactgtttaaggccttaaatgtagaagcaaaatgtcagggtagcaggcagccaaatgccaataagttgtcatgttccgacgacagctgcagcatctcgcacatcctggcacatcctgctcctgtcgcatccacacacatctatatatccttcccttttgccgggggccacttacacttacacgttcgtcgggaatggccaaagactgcgggctccgtcttactccgactacattcacacacattattcagggatgcagtgggtaaatgggctagtctaggacgtttcttgttggaaaaagagtcctgtcttgacgcctgagcacgtccctcatatgccacaagaagctgcacacgctgacacattaatgtccgcagcggtatatcctgtcgcacctgtccttgcccacctgtatattctacggctgaaaaaccctcaaaactatcccaccatttccgctgccatcgctgccattgtcgtatttgtcttatgaactgtcaaactgacattcattgacgcttgacgtgtaataaacgaaacgaaacgaaatgaaatgaaatggtcgagatggcgcgtgggttaaacaagtatgatgggcgttcctcatcggaaatatcatttttcaacccattttatgcttgtccacgtttcttacttccaccatgattttatttattatagaaagttaatttaaaacgggacaatattttttcaatttaataaaaagggaatttaaggcatataaacagtagtaaacatatttaaaaaaaaagctagcacagtagtttctagcactccagtttaaggtaattgtgaaatataactcaatcaacggaagtgaaattccattagcaaaaaccaaccattcaaaactccaagaattctggcaaccaccgaaaaccgccaggactaacaaagcatttttccgggatgaaaggcggtcgcaaatgtggatcaagaggcggaggaaaaggtggaaaacgacggaaagcagattcaggtggatggccatggcaaaagtcgaaacgaatttttgcacaatgcaaacataatgagtttggggaaatgcaaataattcgcaatggaaatcattattgagcactgaaccagacgacagccggagcgcttagaaaatgggcaaataggtgaggttgggctccgatccccactggtcatcatggtggcgggtccacacaggacaggaggagtt

PCR verification status

Line verified as correct.

No slide loaded.