Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT26477 chr3L 6273772–6276035 (2263 bp) CG43168, CR44522 activityactivityactivityactivityactivityactivity
active
anterior spiracle VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14anterior spiracle2
15-16anterior spiracle3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0262787CG431683638bp downstream BDGP FlyBase
FBgn0265715CR4452217274bp downstream BDGP FlyBase
FBgn0001258ImpL317979bp downstream BDGP FlyBase
FBgn0035697CG1016321913bp downstream BDGP FlyBase
FBgn0035696Best224008bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccaggaagtaagcgacctacaagcgtttgtttgggactttccaggaattttcgaggcgtagcaactgtttgtgacatgttttgatttgtgttgtcgacgtttacgagcttgtaactcttcttgggaccctggacctgggccaaaagccaggggagagagtccaagtccagaaccgagacataggtatccatcccagggaccccacaaacttggttggatcgccgccactcactcgacacagaatcgaaatgttatcgatgacattaatagcgattgggggctttcatcaattacatgcctttgttggccaagccagttggccaagcgggctaacatccagatcgttacagccaacttagtactgatcggcctacgcagcgaaattgtaaattattacaatgcaaatgatttccatattgtaaatatgatgtgagtgctgataaagcagcggggctggcaaaagggaaccgcctctgcctgttggccaagtttatgcaaacaaaagttcaacgcattcaaagtcaaggcaagagtcgtttcagagcagttaaagtaattttgtgagtaccgttttgggcccggatcttggcctgactttgggctcgggctcgagttcgggggtttgggtttgagtttgggcttagctatgggtttcggtttcctttggctgccttgaccaccaccaacgtcgccggcaatcaagtcaactccgcgccgaactgtattaactcttctgtctcttctggacggggccacagccacagccacagccatagccaaagccaagccaactgttgctcttttggccaagttgtgccgtctgctgtcagttggcatcttcctgtttgcacaaaacgtcacgttcgagtcacgtttccaactgccatcaatggggtgcccattgccagtgcccgggcacttagtctcgcccatagccgcagttgatgtttcccacaaattttcagccgcgttttcagctctcagtttgcagttcaccatttggccattcggggatctttcggttggtttcgcctgggcgctggcgtaacgcaacaatttcgcaatcacctgacaatgtgacaggtaatagtcgtgtccagcatgctagacatttgcatactcataggcacgggcaagaactgtgaagtaatttcgatgccaggcgagcatcgctcgatggtcacctcatgtctggctatggagcatactgtgataagtaattgcattgcgttttctgcagagagaaaaataatgtttgcatataaaaaaaaatacttctgatagagcttgttgaattaaaatacaatgttttatgatgcttctttttatgtatttttaaatcaaatcaaaaagttacttcgaattttttttgctctgcagttgagaatttgtttcgcataatttgggccattgccagctaaagccgaggaaacccagaaaacctagaaaagccgaagaaaccaaggcgaaccgaggagaatccattcatgaaacgggcacccgccttgaagttgcagttgaaaccgaaccgaaccgactcacagccatataaattgctgagatttctctccgctttgactggctgccttcctgccgtgttattaaaagttcaacccacatgagaagcaatttgcaaactgttaggagaaataaatagtttagcagggaggagcatgagcaaggatcttaagtggcacttggcaggaatttgataaggcccagagagttggccaagatgcaattgcacctgaattggctgagcagcaggtcagcagtttggcaacacaacaccgaaagtgcagattggcctcggctcggaaaaacactttgccctgccattggcttccatttcagtcttcagttttcggtttcctttatttttggcttctttttgctgcttttcacatttacgtcggtgccagaaaaaaagactcctttcgaccagatttttcctttacgttttccaccgatgccaagccttctttgacttgctgctcttctgcctttgactcttgccttgtttgctcttctgctgattatttcacagattaagtttatggttcataaaccagaaatttcaattcaaatgcacgaggggcaaggaggcggcgctggggaaaacgaaagatttttaaataaattacaagcgcattttgttgccccacgttgtaggctaattgtatgcagaggcagcagcgaaaaagtatctgagaaataggaaaaaacccacctgtgggatgtgagtgtgatttgggttgggttcc

PCR verification status

Line verified as correct.

No slide loaded.