Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT26772 chr3L 6862493–6864783 (2290 bp) Prat2, CG14820 activityactivityactivityactivityactivityactivity
active
esophagus, esophagus primordium, head subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12esophagus primordium3
13-14esophagus4
15-16head subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0041194Prat242606bp upstream BDGP FlyBase
FBgn0035718CG1482063533bp upstream BDGP FlyBase
FBgn0035719tow73463bp upstream BDGP FlyBase
FBgn0086680vvl74857bp downstream BDGP FlyBase iFly
FBgn0035720CG1007780098bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

aggatgaggatgagttgtgggtggggactgtgggaggactgtgcccgcgagcctcaattttgaggcagcccctcgtcaccgccccatcttctccatcaagaactaacgcaatcatcgactgccagagtctgaaagcaaccaccaaccaaacgacaagcgacaaatgcctcatcaactcgctcctcttgccgccagaaaacaacgacgccattgcttttagccagagctatgtggctatatggctatggcaacagacccagaccagaccagacccatccttatgccaccacgactcatccacatcgtcgtccacatccacatccacgtcacaaaacccaaaagtgtcaatccaattacctgttcgagcgccggaatcttttgcgacatgtttcataactgtggcagcgtagaaagactttcattttccggggcgaacagcgatgaggccagagatccagggatgcagtggcttccgaactccaaataagataacttagtttgaaaagtgtgaaacgcttaagggtattactctctatattcaaaaccaaatgaatgtatcgtaggaaaataatatacaataataactgatacccaaatagaaacccaatagaaaccttaatattcctgcatccctgagcatctaagcccattccattttgccatttccattgcgagaggaccgagcatgcttcgttggccaagcgaagcagcggttggggaatactgggggatactgttgccaatggcgtttatcaatttgccagctccagacttccgctgagcaagggagatggacagaggccgtcgacgacggaggacggcccacccacaaagaatcccgccgagtaaaaacacaaaccatttccattcagactcgccgtggtccactcattaacacgtgtttacgtagccagtcctttcgatctcgacgcgacgccaataacaaccgataactgcccgatcatgatctgctcagtacatatatacataagtagaatccctagcccaggttcattcaccaacgattccgtttcgattcgaatattattattttcattgttaatatttgttacacgccttttgttcaactggcatgcatccctgccatgccatccaattccatctgaaaactgcactcgagagctcgagacccgttgattgccgatgatgaggatgatgatgttggtgatgactcaatgtgcggctcccgatctcgaggcaccgagtgcttatttagtgactggacgagatcggaggctcagaactggaaactggaaactcaaaactctaaactcgagacatgagacacttctggctgccgttttggttgtttgggctgtttgctcagccactacaaaaccgaaacctggagccaaaactcccgcgattgggaccgcaaaatgggccctgaagtggcgcagacaattcccggctccatctccatctcgcactcaagtgcagcaagatgaccaagttaatttcgagacgggaggcccaaaccgcggagtggttatcaatgggggtctacagcttggcggcgtctgcggcgatgagcccaactggtagccctctaattgatatagctaaatggccgtctatgttgcaggctgcaggttgcaagttgcacgtagcttgttgctggattgcagaaggaggatgcaggctggaggatgaggcctagagacatgtttcatgtcgccagcgcgtacgtggcaatgcgtagaattccatataaaataattaatgaatgtcacagcaaaatgtttcgagcgagttctcctccagctcgagctacagttcctgcttttggactcgtcctcgactgatggcgttcttgctgctgatgatgatgatgaggcctccaactcctgctttccccttctggggtacgtggctcctcctccagctactcctgctcctccttccattctcgtatcgttttgccagcattgcgcgcatatttggcgtcaatattaagtgaaactgatggatgcctgaaggccctacaggcctcctaagtgcactgggagaaaaaaaatgtttatctagggacaagctcccaataatctttcacagtaggtgccgtactacctaacaaaactttcttagagactttaaaatgcataaggtgcatgactttcaaaccccgactccacttaacttcaccttagttaagtatcctttgttcgcagtgtaccgcgtctggcagtcgtccaggtagggcccatctacgtctgctggcccctagtaaaatgcgaaaaaataattttgaagcacactgtggcatgcag

PCR verification status

Line verified as correct.

No slide loaded.