Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT27263 chr3L 7835233–7837394 (2161 bp) Pdp1, CG32365 activityactivityactivityactivityactivityactivity
active
midgut subset, midgut chamber VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14midgut subset4
15-16midgut chamber3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0016694Pdp1overlapping BDGP FlyBase iFly
FBgn0052365CG3236526909bp upstream BDGP FlyBase
FBgn0052369CG3236932309bp downstream BDGP FlyBase
FBgn0035823eIF4E-552747bp upstream BDGP FlyBase
FBgn0003041pbl53976bp upstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

tcgcacaacaattttctttcactgcttaatccaagcgcaccataaattaatcttctgattatgtcaaaatccctatccatcactttaattatatatgacccacataaaaatatgctttatacgcccgatcataaagtacccatttaatagaacgactaaatttaaaaattgaaaaactgatagctgataagctgaagccagtagtcgagacgccacaagtatcgatgggcactcgaattgggttttatttacgatccctaccaacgcagccatatcccatggataaggtacgtagctgtgatggtagtaatccaataaattaccaagaaacttggttgtgcaaagtgattatcgtctccaaattgattggccataaatgtgtcgaggtacgtatctgtggccagggaaaatgttggattaaaatcgttctaataattttctttgtcatttctggcagtttctgtatagtgcaacacctcgttcgcagatcaacctttattgttcatctcatctccggtcgtttattgttcattttcattttgccggcccaatttattggccccatgccaggaggcggcattctcctggtattgtataatgtccatatctctatatctatatccataaccatagtcacatgcgcacatatatacattctgtgtaaatatgtggtgtaatcagcttgtgcctgaattttgctgttgagtgtaatcaaggcaatcaaacaacaaattttcacactttattgcagttgggagaaattttctaaaatttatctgcctttatctacccaatagttgttagggaatttttattattttttattttaagtaatatatttgtggcttttttcttgtatcacttttatgtatcttgtggaatttatttgggctttggttgacatatatttttgatggcggattaagttggtatatacaaattagtcagggacatttttctcaccgaactgcgtcactcagtgatttatgaaacgagctagcaaagttctagttcaatgatttttataactttagagaaggtaagtaaaacacttaacatttaatgggcatacatttttaaaaccaatattttacagaattttttctacttactctgaagctcccaaaaaagaaattatattttttgaataaaaactgatttatgcgaatcttaaatttaccaagaaatattacattgcaccagctaccgcaagcatttataatttccttccataaacttctgtttctttttgggcaaaaacacgatacaaattgggttcatttctggtagcctgcaaaatgtttcaacttccgcagctcattcaatcttatcaaacgtccttggctggcgcagtcaaaaaagttttatgaccagctacccaaaaaactttgggggttcgccagcagggggaaatacttaaattaccgccaacaaaaatacaaacaattcgtatttaactcgtttaaatgagcaattcctacatctaacggtggaaaaatacccatgtttatagagcaaaaggaaaattagaaaagtctaaagaaaagcgcacgaaaaattatgaaaaatgaatgacgtctaaatgttcgcgaaggttaagacaaatggcacatgttgtcgcccattttcagggggaattgacaaaaagtcttaagagtcattccctcagtccacttttcgtgtcatgaaaaattgcgccaagataaataattccaaaaaggaaaacaaattcgttaacaaaggccaaggaaaagaaatcaaatagaaatggatatcaaagcgaatgactcatctgcgttttgccttttgtggttttttgggagtgtagcagatgtttcggttttcggaagaaattcgttgaaattttgatgggctaaaatttcattctgataattgcgctgagcatttgactctttaggcataacaaaacttcctcaaggtgttctcccccttacccccgtcgccattatcccttgatttcagtcttttggtctaggtaaaatgtagcttcagtttttgtgtgcatttctggccatgagccaaggcgtctgccatcttgataaagtgttggccaaaaaacgtacgccacattagtggcagactatgtgcgggatgggtggcgcgggggtgaaggggcaatccccctggcaacacacgtctat

PCR verification status

Line verified as correct.

No slide loaded.