Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT28507 chr3L 10253266–10255414 (2148 bp) can, CR44540 activityactivityactivityactivityactivityactivity
active
ventral epidermis subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14ventral epidermis subset2
15-16ventral epidermis subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0011569can3743bp upstream BDGP FlyBase iFly
FBgn0265733CR4454011579bp downstream BDGP FlyBase
FBgn0265732CR4453912396bp downstream BDGP FlyBase
FBgn0036080Or67d13038bp upstream BDGP FlyBase iFly
FBgn0036078Or67c15461bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccattccgtagatatttttcctaccataccctgcaattgaaattcaaagtgcgtactcgcactccaaattaaattaacccaaccgatacttttctgtcttaactgtgcactgggatcttgttaagcagcttcgatgtgaaaggcgatcgcgatcctttcaacgctgttttggaaaggatctgtctgaggtctgagttcctgcttatccgcggcgtcattaaattcattaaaagtgcatcaaaatgtatcgcagaggacgtgtaattttcatgtaatccatcagcgtgcagccattgacacccagagggcccttcactcgacaggtaatttttaggtatattttatatacaaaaattatgaattacaatgtgcgccgcaacatgttaataagatgaagtacgtgaatatgcactttcgggctggcaaattcaattaggcggaacgatccaagacactcatgtgcgataagtggccgccacaaaagccgcaaagccagtcgagtcctatgtcctagtatatagcttatcctcttccgatctgcggttaaattcgcaagttgcagttgcagctgcagattcattgtgtgcgaaacgagtcgaatgcgtaatttaataaactcacgagggcaactaggagcaggttcaggacatttgcgacgcctgcgagccattcggttgaaaactagttggtggcgcaactttaatcccgcatcgcatttgcgtaataaaagtttcaactttattgttaattaaattgccaggacatgtcgtggtcgttctcgtagtcttggtccttgttcagatcgtgtggcccagaggcctcttgacaacgcagctgccttttttgggccacgtctatcaatgtaaacgtgatctggccatagcccgaaagtgtggaaattataataaatttagccgcatttggcccgcagtttctgctggccgtaattatgcagacaccttgccagcctttcgatctccactcaaaattggccaagtgagctgcaattgcatattgccatattgacagcgtgatggatgtttggatcccaagtagttatacgccgaatcgaaatcgattgagctgctcgctctgcaaaaggaggctttgcatgtatggaaaataaagcactgaagaaaaaatcattgacttaaagatatctgttggttattttagggaaatatatatttatactacattatatattagtcaaaattcctaattcctaaaaaaagatacaaggtttttgttaaggatttacccaacaatttatgcaggagcctttcgcatcctttttttattcgagtgcacatactgccacgggtggtccgccgtcaagtggctggacattaagattcgaccggcgactaccgttggccatttaagacaataaatttcataaatagcttatgcataaaatgcagtcggtggccccttacccattctactggccactcgattcgaacgtggctctcaactcccgctgcgttgatattaattggacgacataattgcggagccacgttggccgtaataatgcggagtgcggttcgtggggtaattgctctggaaacacgttccactggcagcactccccaatcgaagcgaactaccggagttggaatttgtataaatataaattttggctaacatcgagggtcctctgcccgaactgcgtaattatgggttttgtggcacttggcttttgcatcgctgcctttttggcggcacacacttgaaattatcggtgtgtgtccgccatttaatttattgtctttggcgctgccctaaatccaattgtaatacaatccgccgcatttatcatatttaacaaccgactccaaacgcacacacatcctgtatttaacggcctgctaatacgcggtttaagtttaatgagtgcaaaggaaggggtcgcttatggcgcgtcataaaaggttgcaagtaaagttatgttgcaatcaaataagaatttttaaatttacctaaacttgccctttgccactgcgagaactgtttatttcaagccaatcgattgtgaaaatattcaaattttactaaaactgaaatatttgatataatagcctcaatttaattttgcatatttttgttacctttgcgaggatcttgtcagcccgcagtccttcag

PCR verification status

Line verified as correct.

No slide loaded.