Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT30530 chr3L 14113093–14115346 (2253 bp) Sox21b, Sox21a activityactivityactivityactivityactivityactivity
active
hindgut proper primordium, hindgut VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12hindgut proper primordium4
13-14hindgut4
15-16hindgut4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0042630Sox21boverlapping BDGP FlyBase
FBgn0036411Sox21a11876bp downstream BDGP FlyBase
FBgn0000639Fbp121941bp downstream BDGP FlyBase
FBgn0036410CG810034030bp downstream BDGP FlyBase
FBgn0005592btl36765bp downstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

gcctcccgaaactccatactcccactccccatcccatctacacccactcataatggtaaaatactaatttatagatacattgacagtgccaagggcccaactggccatcaaatgagcaactctccttctggggacgacaccttcgagagaatggattgtctgggggctgtggatgtggatgtgaaggtgggaagagaggtggtgcaaaggcgccctggacataataataaacaagaccagcagccggtggacatagatgggggcatacttgtagatacaagttgagcagttgaataaactagacccacaaaaggatgacaatgacaatgtctatgtttgcccaatgtctatgatgttggcgccccttggccaaacagagcactccggcacttcagcactctagcactgcaaggcagtccgagaattttctcctcaccggctggctgaccagcttaataattgatacgaaaaacaagccagcagttggcagttgcgagatatttccgagactctttctgttacaattaacaagtttttccggcctggaaacgttgcacgtttcgttcgcctaacccacagatcaaatatttgaccatcaccagttgcagtttccagtttttgtggattcttcgttttggggtctgcagttacactttccactcacccggacaatcgggctacttatgggattacttagcttctcttctgctggtgggttatatttgggggccccactcataacgcgaccaccgattaacttgtttgcccagcaatttaatggctttagttggagcgttgggagttttctccattttctttgccctccgtttggccactcgaaatctggcttatttgctcattctttgttgcgggaatcgtgagaataagtcctaagttctgacgggactacttatgagtaagaaaaaaacttctcacactgggacctatacgatatattgtttttcaaagctggttaggtctgaatatcgaagttaggcatagttatttaataatttagaaatttattgacagcagcgcccttaatttgtccagggatactcttcaaataaaatttgaagacagtgcattgtgtctgcagacatgtgtgatataattttcgaaagaatacatattgatcacccaaacctattaacaactttgaatctctgtattcttgtaatatcagtttcgaatgtattaaaacaactaaaaacttaaaataggtctcgctatggtgaaattcgtagcatacttaaaaggggtttaacaaatcttcatctaaataaagataatgtccattgtaaaattatgttagtgaagggtagatccagtaggttgactaaggtgatccagaaagtactaagcaattttccgcggtattgtcatatgatacaccccttacctaacgagtaagctttgtttacaatttcttaaaatctccgtgaattttttgtttccgcccattaaacactcgtttcccacctgtcagatgcaactggcaggcagcgtcgtaaccttcacgcccacccaacggcctcccgcccacgtaaacgcctcctcgaaagctttttccaattgcaaactaatcaattgttcgcattttattaagcaacaaaaggtgatcgtgggggtgggaaaaggcttgagttcgaccttttgtgattgtttgcttttttcctgtgcctgttcctgctccttggaccttttgttccgccgggtccaacggctcattcatccaactctcctcagctttgtctgccattattaaatattcccggtggagtggcaggagctttgattaaaaataaagaacattggcgaatcgacaggtttttcaattatttgcgaatatacaaaacacgataggaaagacttttccacgaaaggcatgagcggtgttgttgttgctgctgtcgccttttgtttgtgccaccgctctggttgttggtaattcaaatttccagacagtaattaatgacagttacaatttcaattaagcccacgcgcagttctgaattgttttctataacattcacttttattttattttattctattttattttacccactcatatatacaatttttttcagccttttgtgggctttttttgttttttgtttggcgtataaaataaatggcaacgccagcggcaacggcgtctgaagctgaagagccactccactgtagccggtgtatggggccctctcgctcgcacacgcacgcaccgtctctttctgtcgcactcggacca

PCR verification status

Line verified as correct.

No slide loaded.