Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT30534 chr3L 14120741–14122834 (2093 bp) Sox21b, Sox21a activityactivityactivityactivityactivityactivity
active
ventral epidermis subset, head epidermis ventral subset, ventral epidermis primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12ventral epidermis primordium subset3
13-14ventral epidermis subset4
15-16head epidermis ventral subset4
15-16ventral epidermis subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0042630Sox21boverlapping BDGP FlyBase
FBgn0036411Sox21a19524bp downstream BDGP FlyBase
FBgn0000639Fbp129589bp downstream BDGP FlyBase
FBgn0036410CG810041678bp downstream BDGP FlyBase
FBgn0005592btl44413bp downstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

cgtggtaatattttcaaaagaaacaatgccgttgacacatttcttgatctttatgtttaaatcatctgttttataaatagctaagcttcttaaaataatcaccaagaaattatttaagtagcatacatttagcattctttgtttacttaaggaggtaagtgcgatcccatattgtacgtattgcaaaatgtatatgtataatagggcttgtacaagataaactattagttgcttgcttttattaaagctaaagacttattaaattatttagaaaatataattttttaggatttacagcctatagtagataaaaagctactaaaaagttgttgagactcataaatctaaaacataaaactatttctggatcgttacgtgtactcaataattttggaatatccttgggtttatgaagtggccaactgtggttcgaaactatttatctttatctgtccaattcgactgttttttctctgctgccatattccgcagtctctctttttggccctgttcattggcatttctggccatgcaacgcatcgtggtcaataacttgcgttgggctatgcgaggcgacatctgtactgcttccgggcattaccacttggtgttaaagtaaaaattgcccaagcatgcgtattaagcatgaaatttatattaaaagaaaagggggagctgggaacggggagcggttagcaaagggacacgcatatttgtaatccttatggagtgcaaacaaatttctgtgttgtcaagttgctctccatatttttgctcctcctttttatgttgcgaattggcagaatacactgagaaaaatgaattgattatgtttatttgtgcctccactcaaggtatacgctaaatttcatattttgaaaacactacgcatatatcaattgatatgaagttgcatttatgtttggatttttattttcgaactaatttaattttgtgattattctagtaattgaaatggcaataaaaccgaaaatgactatgtggacataacacttgttccgatgtggtgcagtgtcgcagttgcagtatcagttgcaccacagggccaccatccgaatcgacggttgcaccaccagctgtgcacaaattgcactccagatatttttatttgctgtgaatatgccagctcctccttttgattcgctgcacctccacgcagaccgaaatgcagctccgatatttatttgtaacggaaatgtaaccgttaaacccaaaagcgtgggtcttctcagggtgttaatctagtagccttaatagataacccaccagaggcaccttatgtccgactctttctcatggaaatcgagtgctgaagccgttcttctgtttcggacttcgtatcgtatcgcagtaggagtaaaattaacccgctggccacttgagtttcgggggccatatagatccactcgtaacccccgaccaagttggccgtgttgttgctgcttcgcgttcatttgttcatccgtttgttggtatgtcaaacaagaattatgatcggcttagccacatgctgagcccgagatctctcccccagccatattcttctgctcattctttagcggcgaagaggagtctcgcggtctgcagtcttccacctcgtcttcaacacaggtagagctttaagtgtctccactttgtgttgaaatgtatcgcggatacgcaccgggttttcggtcccagcagaccctccattcaaaagtgtcgtcttgcccgcccgctgcgatcggatcttctcagggccctaagtcgctgggccccctaatgtttgtaattaagaactttcacactcgcaacaatcgcctcgtaaacgtgccagtgtctcgataaccacataccctgctcctccaaggtttagtgtcaagtttgtgccaagggctatccaaagggctatcgaaaagaaaaagaaccgatacaaagtcagctaaccatatgtgtgctgatacagccgggtattaattagaattttttcatactcttctttggattatgcctgtttttttgagcaaatttataaagcgaacacaatggccaaaagaatggcgtaaaaatattcgattgacatctggtgcgcaa

PCR verification status

Line verified as correct.

No slide loaded.