Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT30598 chr3L 14234456–14236568 (2112 bp) CG7906, CR44561 activityactivityactivityactivityactivityactivity
active
ventral epidermis primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12ventral epidermis primordium subset3
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0036417CG79063085bp downstream BDGP FlyBase
FBgn0265754CR445613649bp upstream BDGP FlyBase
FBgn0265753CR445604637bp upstream BDGP FlyBase
FBgn0085273CG342445416bp downstream BDGP FlyBase
FBgn0036416CG79246748bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgcagcagcaaaagtggagcttaaaacagctcaagtggagcccgtctcccgactcagagcctacttgattatttattaaaacgaaagttaaacagcgaaaggaagcaattttccatataaaagaagcggagttcgctgctgaggaagccgggattcgcttggccatgtgtctatgcaagttttgtggccccctccagagcgtaattgccatgtttaaagtgtgattaatttgtaatcatcaaaaaggcaaaaacagccatgtagagaacagctctgcagctcggtggaagctcggcaaatgtttgcattttaagttgccgggcagaaaggcagaaacgaaacgaagtcagagtataaaagctaaaccaaaagacaggaatcgctgccgcctcaggatggaagaggggcgttagtcggtgggggggcgtggcgtcgcagaagaagtgcgggacaacagcgtgttctctaagtaattgagtttgctcgctgaggcgttgaaagtggccgagaatcggggaaatcgggcaagtggaggctgttgagataatgagccaactaagatacatatatgcataaagttgaacacttttatgttgcggaatagtaatcgaatcgttggccaaaacaaaaaaacttaggatactattatccttaaaacatacccatttaaaagatagcaggaaagcttatcttcaaagaaagttaaatattttaagatgttatgataatgaggacatattttacatgttaattcacaagattgctctgttatttgtatatgctttgtatttcaagattcatatgagtttctgttattttattttaataaaatgaaagctagcaatcgattcacataatacctcttattttgccaatgtatttcaactctaattatggccaatctgagaagtgaccaaacattctttatcaatcgtttatcgatcagcagccatgattgccaatttaattagctgacaactttattagcacctaagagagagcaatgcggatggttttggccaagacagcgcagtaaacacgattctcagctggctacgactaattacagacaccggctgttcgaatgcatccagtagatacgcgtacgagccataaaagccaatcgcgaaagcattgccattaattaagccaaagtataaatctcgcattgctccaaagccgaaaaccaaacaaagcaggaagctgccaaagtcatctactcagaccgcctgccgcgcatgcgcagctcagaatggccatcagagtcagctttcagtgcaaaaaatagctaggagaaaggaacatttaattaacttaaaaactttatggtaagctatgaatgtttcttataaaaaaaaatgcattaaatcaattggcacaactacgttcccttattccagaagatcaaataattaggcaaaatcgaatttaaaaaaattttatcaacattttattgactgagtactgcgccctaagagggaatattaatttattaatttaagtcaacatttttggtcttttgcgcaagttgtatatgattgtgaaataaataatatatgttttacttaactatccactatgatatttaaatattttaccttccacttgcctagacgcgctttaaaaatatttttttcttttcgattggctgcataactaaacggctaccggcttttgaccttttgaaaatagccagataaattttccacagcactgatggccatgaagcgaaaataatggggaggggccgggaaaaggaggcaaaactgcggacccgtccagcccgacattccaaataattacaagctataaaaatttatgagcgccaaggattttcttttgccaccacaaaacgcgaatgcgtgtgtgcgcccggggctctgaccaaaagaagtatctacgtatctcgcagatacaacgcgctcacccataaaacagtcgcctcaactgcagtttgtccgagttcctcctgctgccggttcctccgccggttttggcaagccttttgttctggttttgtgcattgattgaaaattaagttgtgccgattgggtggcgcactcctcaatctatcggctgatttatcattcaatcatcctgtcacgaaatgtgc

PCR verification status

Line verified as correct.

No slide loaded.