Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT3275 chr2L 6501559–6503679 (2120 bp) CG31637, CG9550 activityactivityactivityactivityactivityactivity
active
posterior spiracle, proventriculus, posterior hindgut VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14hindgut2
13-14proventriculus3
13-14posterior spiracle4
15-16head subset2
15-16posterior hindgut3
15-16proventriculus2
15-16anterior hindgut3
15-16posterior spiracle3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051637CG31637overlapping BDGP FlyBase
FBgn0031826CG95503094bp downstream BDGP FlyBase
FBgn0051638CG316384572bp downstream BDGP FlyBase
FBgn0266001CR447755865bp upstream BDGP FlyBase
FBgn0031824CG95477028bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgcctcctctgaaaagcgaaaaacaattaacacactaaatcatgagctgacttcgtatactttagccggaagttgggtcactaaatttacaaactcttaaggtttaatttctcttttgccctgctaactttgttttcctagttcgactcctcctcctaatctattttcaaccatttcgatgctgactatatgcttttatcttaacttgtttaccttaattaaaagagcaagcttattatcttatttttttgtgcttatattagtaaccaagacttgcagatagtagttaaaactgcagctttgtttgttttccgataactttaagctctatttcaaatggaaaagtgcttcataaaattagctttgtataagcactttgcacttaagttgcgcctctcactcaattctttgtactctccttcgcggactgcagtaaaaattctttcacactctattaacttggccccgctggccgctggccgctgggaaatgcatcaaaattccggaaatgctgaccagcacttggatttatgtttgcctgcgggccaacatcatcccagccagccacacacttagccacaatttgggtcagtgcgagcattgtggggcgaaaagccgtgtttggtgagtcactaagcgaccgctaacttggcttctaattgtcgattggccaagtcttgtgccggctgggtgtgcccagaattttgttttttgggggggaaactgggcgaagctttcccacaattatcgcgtatacgccgtgttggacggtctcttaaatttaatgcccaatgagcatttcatttataaatcacacattatttttatgtgatttttcatggtctccttcccgccactcagttgcgataagaaagaaaatgtggctaatgaaatgaactaccaaatggggcagttgtatatttataagtcaatgagtcacgagaattgcaaaatttatcattactactacttccattgagcactgaacggtttgaagcaatcacggaatgtaaattgtattattttattattaaatcatttcacaataagtgtaactaaaacataattttaatgaaaattgttcagcttaaggtcgggttttattaaatttcttcacactgttggaaaagccttttcatttagttttccccggcgcgctacggttttgtggccgctaactttgagaggcttttgccagcaagtagattaaaattgtgagcattgaatgcgcccaccacaggccgcacagtcggaagatggcgaaaatagttgcattcaacatctggcaaaagaaccaaagagagccgaacgagccgaaagaaccgcagaagccacaaagagtttgggcccagtcagttttagttggcttataatgagcaaagtggccattaactcaaaaacttttccgcgctgcgttttaaagcgggccaaaacagccagcaaacaatatgagaacgagacggaagaagaagccgctagacgtcaagaccccgcggtttttggctgctgtaagacccggttctcggaagcccattgcgccatagacctcattctgggccgtttatctcgttttgaaccttttgacttgacagttttgtcaaaaagagagagagagagagagagacggctatggacggtgcgaaagagagcgatcgtgagttcagtgaacgttcaagtagaatagttttcatgcgcaatgcgggtgtatggatttctttatagaagtagatatattcactaggcacaaacaaaagatgtgcactattcacacttagcataaagatagtagttttcttttttttgactagctaattgaaattggagcatgtagagctagtgtagctcatgctcaaacgagtatattaatctgaactttcttttcgaaaacagctgacatgttatcaaatcgcatttgaccgaaatataactagtctgtcagtcagtgtggaaagagcattgagtgtgctagtctatatttttttccattttttgtgtgtgccccaaactttgtatcttattgcatttgcaaaaaaagcgaaacgggtttcgttgctggctaagccaaacctttttcttatttatttatttttattttttgcccgctactattgctgttttggt

PCR verification status

Line verified as correct.

No slide loaded.