Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT33008 chr3L 18851716–18853842 (2126 bp) mir-315, CG6865 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0262461mir-3152355bp upstream BDGP FlyBase
FBgn0036817CG68655031bp upstream BDGP FlyBase
FBgn0036818CG140747609bp upstream BDGP FlyBase
FBgn0036819dysb9155bp upstream BDGP FlyBase iFly
FBgn0036820CG685210614bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gtgcgtgtttcgcaatttggtttgtactattcacaatctaatcatattctaacatctaacaataggatcacactgaattcaccaaatttttgtagtgtccttagttttctaaacttgttatttaacaaaatctataacaatagtccagctgtatctcatgtcccaactttggtttccttttgtttacctgatcacaatctaattagccaacaatgaatctcgaaccgcaactgtcggaattaaacttgaaccaaaagttgggagagcaggaaggtaaacaggatttttccgagcaaatcaattagagcatttccccaaaaaagttgcaggttaaattgttgaaatgccagagcttgccgggatccatcaaggaatcccttccagcctcttggcgcaaccattacaaatggctgcgacttggctggctgtcagtttgggttcagttcgtgttgtgtgttctgttgcgctgtgactttttaacctaatgaataataaattggcccaattgtcacgcaaaaacaatgccgcggaatagatggataagggtttgcactgcgacctgacatcaggaggtctgcgaagtttacttctccaaattttagacacattttccatgcctgcctttccattccaatccattgccgcctgccttttctttgctgtttatttccgctgaagtgtcgccttcgatagattttggcatttgttacggaacttgcatccacctgggaaatcggtggcaggcatctagcaatgattagcacttgctctaccttttcctttcggcttaagtggcgcccacttgcattcgtttggccctttcgctgccttcccggccaagtcgaaaagtaattagcatattgaaatgttgcacaggcctcgcctgcggaacaatctcataaataatttagccagcatatttgatgcgcttcggttgcaatgactgcatttccccagttctttgcgattgctgcaatgttacatgttgcccgtgtgctggcttcaatatttaattgcgaaaaatctcccagccgcgaaaggggctattcctcggctacttcatccttagacctcttaaaagcgtgtcaacagcttgtcaatcacaatttcgcaaataaaatgtaagtgtcagctcatggaaatttagtttgcgaatgtgttgattgtgttttagttgtggctgtttagaaataattggggagcggtggggctaaaaacaaactgatgtggggtattctctaaggcattgcgtgttccaagtacaattgccatacaaaaggttcacgaaatcaaaatagtttcatcatacctacacaataataaaattccaaaagtatcttaagctgaagtgaaagaaataattttacataaatcttgataaattcaaaagttagcatccatcataaaaaaacgcatgcaattcacaccaattagaatactaaaatttcattagtttcaaatttaaaaatttgatatgcatcagtatataggaaagaatagctattctatccaactgatatatgtatatatgcgagagtcactaaagttattacatcataaaccaacgaatatagttacattcctaaaaaagcaaatttgaaataaaattgaaatacaaaaaaacatttaacttcggatgcttttcaatttatagaattattttacccataccaatcgtttatatttattctatctatttccaactgactaactaattttatgcggagaatagttaaaccttttaagaacttccaaactgaaacatacaatatcggtcaaatgccattaaaagaactaaatgaaaaccatttaagcaattaaaaactgcttaaattagccaagaataaattgaaacaatctgtatctccataagcgaaacgaaataaactaaaaagtaaaattcaaaatttgacataatttacgcctgcgcaacaaggaatagtgtaggtcctcggcaataaaaaaccaatgccaggactctcattggtcgccatcgaaaaggcagccgagcgaaagccgagctgcggtcgtttgcataacacgcatacgccgcataggcccaaaggataaaagccgccgacaacgagggatgttgcttccttgttggcttccgctcggttcgcgaag

PCR verification status

Line verified as correct.

No slide loaded.