Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT33917 chr3L 20656400–20658642 (2242 bp) CR44685, CG13251 activityactivityactivityactivityactivityactivity
active
posterior hindgut, anterior hindgut, hindgut anlage VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10hindgut anlage3
11-12hindgut proper primordium3
13-14posterior hindgut4
13-14anterior hindgut4
15-16posterior hindgut4
15-16anterior hindgut4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265896CR446859175bp downstream BDGP FlyBase
FBgn0037014CG1325122391bp downstream BDGP FlyBase
FBgn0265893CR4468228650bp downstream BDGP FlyBase
FBgn0001320kni29030bp upstream BDGP FlyBase iFly
FBgn0265892CR4468129817bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tattgcctttgccttagctggctggctgggaaggtgtggtaaagtgaggtaaagtctggctacaagctacagttactattgagtctcgcccgttgccaagttaaagttcaatgatgtcattacccactaattcacacctaagttttgaatacgccgcatgccgtcagagctcaggccttatgccaatcgatcgaaatcgagaattatcattggagataaataacattatttggccaatggaattgttgtttcgtcttaaaagagaagctaacgagacagccagaattaaacgtacaacgaaatttgtctaccccctggggtgatatattttttttgttcgtctgccaaatttagttcattgattgctgttaagcgtacgttttgttcgtatagtatagatatagatatagatatgtatgtttggtttttaatggctttaggtagctgccgctgattatcataaataaaatatgagttctggctaagtttgttgcttaagtcttttgttttttcgtgttggtttcgtccctccatgaaatgtcaacgaattcgtttactggctgctcaaagatagatattttcatgtgaaaatgagttcaggcaatgggttccactggctgagtgcctttcaattgtctaggccgttctgttgttgtcactgccaattaacaccagttgcccaaaaagttaaaagttaatttaaatcaatgcgcaatcgcgagagcggcaaactccactcgtgcgtcgctgaaacaaatgccaaatatccactatgaaaagcccatggatctcgttggttgggctccaaaaagtgttaagtatgcctcgtctttggttgcttattttcggtgcccactgtttgctttggcaatcagtttgttgataatttttgtgtgtgtgctgtctgttgtttgccatgtttttgtaccctttgtgtgtgataatttagacaattcgtcgataaaggcgcacaacaagcttctattttcctcggcttttctttgtctctgcctgtttgagttgcattttaattacgtctaataggccaacgtacgtattgatttgtcttctgtttaaagttccatttagcggccaagttagttagcttttagggccccatctttgggtggtcccgttcacacggctctttctgcacattgtccgtttaaggtattacgagtattcccatgatccatcatccgatcgacctcaagcgagcattcaatcattgttagtacatcaccacccaccgcataactttcgtacatctgcaataacaacaacaacaacacaaatggccatgtaaggccaatcagcgaaaacttggtcaatggctataattgcccgggcccaagtgttaatgcttcgattcgaataacaggggagttttcggtttcatttgtgcagcatcaacagtaacaataaaaacgtgattaaagatgctatgcaaagcaattgttattcgataaaggggtatcaaaggctaaaatggaaattacattacttgcatgttaaatatatccaataaaaatgtatcacaatttataaggaaataatgaataaatcacttttactaaagcaaaagaaaataggtgattataaaataataaaatgtgtcaattgtggtcattaatatacaaaattaactatctattttaattcgtagttagccaattttataattttcgaacgtgtaacataacaagtaagatatattggtgcctcgaatagggaaaaaataaaattaaaacactcaaataaatgaatagccataaaatcgaaaattaaacctaaatcttggcaaaactaccaatcggttttacttccagggcatcgatagctccatcattagcttggccccttaattccatgttattgaaacgaatcacaaatctgttgccttttgcaaatcgctttggctgcgcttaatgtgggaaaatgtcgatggcagtgggcttcacttggctttactccgggttctcgggctcgcctctgtagcgatggggcatgccccaaaagccgggcttctggcccactcccagtctttccccgatccgttcacctgactattaaaatcaaactatcgagcagagcgagcatacgtcatgcatattattacaattacaaatgtacgaatggcatgacaaaaatatttccacatgcattttttatgcttcatttcctgtgactgggcatccaatcgatgggagtcccaaagtttttgggaaagctcttggctgcat

PCR verification status

Line verified as correct.

No slide loaded.