Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT34389 chr3L 21576310–21578488 (2178 bp) TfAP-2, CR43939 activityactivityactivityactivityactivityactivity
active
antenno-maxillary-labial complex, head epidermis lateral anlage, brain broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10head epidermis lateral anlage1
11-12antenno-maxillary-labial complex3
13-14antenno-maxillary-labial complex4
15-16antenno-maxillary-labial complex4
15-16brain broad1
15-16ventral nerve cord broad1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0261953TfAP-23618bp upstream BDGP FlyBase iFly
FBgn0264567CR439395992bp downstream BDGP FlyBase
FBgn0052441CG324417337bp downstream BDGP FlyBase
FBgn0262330mir-1939090bp downstream BDGP FlyBase
FBgn0052438Smc59688bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ttacgtgcgggcaaaagaccaaaagaaactggacgagcacaataaattatttaggacgactcgatctcacccccgaatctggaccgcaaagttcgtctcggaatctgagaatctcggaatctggggaactgtggagcgttggagcgctgggcgctgggcagcccgaccagctcctgcgtggctccactcgtttatcttgccagcagaagacacctcggacactcagacttccagaccaagtcggagctgaagtctcagcctcgataattaacacacaagcgcggggcgtgatgagcaacggaccgcagaaccaaacaaattattaaaaatgaattagtggaaatataaatatatgattttgaagtcccatgaaccgctggggccacgtgcttctaggcattcacatccacatcccatccacattgggccctgattgcgccgctggtcaagttgccttcggggtcgcaactcccagctccatgcacccaactcgactgcaattgcatttgaatgtttttcgaggcttcggcctctttttgtttaaatatataaaagccattaaatactaatctattctcgattgctcttcttcggcttcttcgggcacctaatgacgcgcgttcaacatttaggccaccatcgggccaggggaccagtgggtcccgtccagtgcaaggaggcagtgcctcctccctcctaagtatgattaattaataatgcaggtaagcatgtagttcggcgtccacatgcgcatgtcggtatgtgccacagtggctaaccgtgttattatgcacattagccaaacgtgtcattattttattattattgttattccgatttcgtactcatttaaatgctcattaataaaatcgaactgcgaagatttcggcagttcatttcgagtaaccgaacttgttgtgggctggagttgctcctttaccacgaaatcctccttaataataatactaataaaacttgtgtggaaacatgcgaataaattgatagttgatttttatatcgaatattttcattaaaaagaaccaacgtcagattaatggcaaattcatttttaaaaacttcaagtcgaatcttctatttaaactttccttacaatacaggaactaatacaagttacctaattgattttcctaaaactacacaatgagtgtagtcaatgcaaatagtggaccatatcaaagcattatagaaatatgatatttaaatataaagggatattattactaaaaaaaagcgtgtgtcctaacttgttactaataattattattttatatttcttagttataaataaggtttttagcccagtgccaatattttgatggcaactgtagttttgcgcaccttaacaacgaatgcatcgtattaggctagtttaaaaatatgaaattaataaagcaaatacaacatcctaagccaatgttttggtgcacaaattattgattttaaaaaagcgcagggagtttccttttcgcgatgcccctgcgacattttcctattttgaaaataatggaggcacgcgaaggtagcagataactaatagggcattacacggccaagattcagacataaacatcagagcccttccactgaaatgtatctgtatctgacgagtgtatctgaaacgtgcaaagagagcctgctggccgctaagagagcgaagagagcgcgccagagcgagacggcacacgcagagcaggacggcgcgtgagataaatagagtcgggggtgagtcgaagatacataccgcctcgaacgcgctgcctgggaactctgccagcatccccaaaagcgatatggtatgtacagcccgagctgaatgtgtattggggctgttcagttgtcggtgacacgggggattgtaactcactccccctttttggggcttatccgaagcagtacctctacactcgggcaaacgagtggggtagttcttacctattggtacctgtcgacgttaagcttatacccaaataattttgataccttcagatatgaacggtatttgcctatcggagtatatgctagtcttaaaaaatatgtgtttataaagattagtttgttctcatgcatctcttatcttaaggttatccaaatataacttaaaataattatctattaatatagctgttactggaactgttattttccaaggagataccca

PCR verification status

Line verified as correct.

No slide loaded.