Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT39431 chr3R 6213961–6216141 (2180 bp) cwo, CR44938 activityactivityactivityactivityactivityactivity
active
malpighian tubule primordium, proventriculus primordium, proventriculus VDRC

Annotations

stageannotation termintensity
4-6posterior endoderm AISN3
4-6anterior endoderm AISN2
7-8posterior endoderm anlage3
7-8anterior endoderm anlage3
9-10anterior midgut anlage3
9-10posterior midgut anlage3
11-12anterior midgut primordium3
11-12malpighian tubule primordium4
11-12posterior midgut primordium3
11-12proventriculus primordium4
13-14midgut broad3
13-14proventriculus4
13-14malpighian tubule4
15-16proventriculus3
15-16malpighian tubule3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0259938cwo19bp upstream BDGP FlyBase iFly
FBgn0266243CR44938855bp downstream BDGP FlyBase
FBgn0020379Rfx10172bp downstream BDGP FlyBase iFly
FBgn0045443mthl1112793bp upstream BDGP FlyBase
FBgn0037814CG632514728bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gccgccagcgagttttattcattcatttcgattctgtctcttgtcgcgaacagacgtttgggaaatagttcggtgcgggtgacgtgacagtgcaaaaattgaatacaaaaaaataaggcaagagggagagcaaataaaaaacagcaaaattagctggaggggcaacaacaaatttgatacatacctatatatacgtgctttaatagtgaaacacacgcacacgcatcacgttgctcgctcgcccgtacatatatttatatcggtgtgtgtgtgtatatagaggcggctggtaaaattccactgtgaaacgaaaggaagttattgttttctgtggctctattcatgtaccatatatattaacaaaacaaataacagtgtgtgcataaaattgataaaagctaaaaacgtgtaaacaaaaattaaacaaaaaaccgcgcagcgcaatcacgttttccgacactatttgcgtttcttctgttgttttttgtgtggataccgcgaacgaggaggaattgttccaacaagtgcaccttaattgaagctccagtaacagaagaaggagaagtacgaaagaaaaacaggaggaggagtaaacacgttatcgctatcgttatcgcacccaaacactagcaaacgcacacccagtgataagcgaaaaagagtaaacaggcggtacacacttatcagcatttttcactcgttccaacataaataaacaccccgcttcgtaatgcccttctaaaatttcgaatataaatccgggacgtgaaacgtgaaaaagtacccgaaagaaaaatatctcatctcagctttgaagagaaaagtaactcgccgcgcagtgaattcgccgcacagccgtcgactcgacaacctgtttgctcgcccataaattcgccccggcatttatctcacaattatttctgcactgacgtaaggaggagcacttccaccattccaccgcaactgcagcaaaccacgtcgacgcagcagcagacgcagcaggcgctccacaaaacgttcacactgcccaggagcggattcggtgcgtttccagtgcaagcagccggaggaggaggaggcggaggcgtgcggagcggttccgtctgtggatcgaggagcaggagccccattggcaccaccatggagccctattggaacgagacgaacggacatgccgcccatccggtcaagtatgagaggtaggtatactcagcacagatcgccagatcccgctgcaagtcgaaagcaaataaaatccaatccaatgactaaatcgaaccactcactttcacctgtgcgcgtttagcttaagcacgcagagaaaacttatcacaaaatgtgcaacaatccgaaagccctctccaattagttgaaaattgttaaagttttatccgtatctgaacgacaaattaaaccaaatgaatctttcttaaataaataacaatccgtaaatttttggataagcatattgctaatttagattcccaagacttgtgataccttttctctgtgaattatttaatggtttagtgtatctaagactcgcttctagtggttaagcctaagtctccgcctcctcttctataactcataatcgttatgtgcgtgcatgtcaggatcgggtgtggaccattcggatctgttttgggatgtgtgggccgcgtatttttagccgtcgagctagaaagcgttttgcatttgcaaaacaaacgcgaaaatcgggcgaagaaaacgtgggcagacactgtcgagaggctattcttggccgagatgggtgctttagttttgctttatttcatctttattttttcgtgtttgccagaaggcaaaacacaaaacaaaatccaacgcacgactcgcaaaacgtgatgtttcgttgattttttccctgtgagtctcccaatccccccaatctcccattccattgagtttgtatttttgaacttgaatttcgtttaaacgtgtccgagcggaatcagaaaaaagtgcgatttgcgttggtgtggccagagtggggattaataatccaagcgaagtggtgtggccagcgctgcaaatgagtaatataatcacggtgcttaggggttttacgcctgtctgctaaatgtcaacggccaaacgtggctataaatatcagttaacaacagcgtgggtctatgctccccaaccaactcctttgag

PCR verification status

Line verified as correct.

No slide loaded.