Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT39549 chr3R 6430745–6432955 (2210 bp) hth, CR44018 activityactivityactivityactivityactivityactivity
active
amnioserosa, amnioserosa anlage VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10amnioserosa anlage2
11-12amnioserosa3
13-14amnioserosa4
15-16amnioserosa3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0001235hthoverlapping BDGP FlyBase iFly
FBgn0264788CR4401834256bp upstream BDGP FlyBase
FBgn0037818CG646570537bp upstream BDGP FlyBase
FBgn0037819CG1468872714bp upstream BDGP FlyBase
FBgn0265161CR4423077609bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

acctctgccgaagccaaaccgaattccattagtttacacactatgcacactatacttatactcactcataaatcgcatccttatcacgtttgtgtacttcgggtattgcgcccattaggtgattaccgaccggcgatacatgactaggtgttccatgacccccggcccccgaatggtagccgtgcatgcccactgtggccgccgccgccgctgcgtgcgtcatgtgcggagagtggtgcgaggggaggccctgcagtccgggcggccggtgaccggcgtgtggatcgtacatggccgctgctgcggctccggagtccatgccgtagccgtgtaggccatcgtcatactgtgcgaatgagatgggaacagaatgttgaattagtgggtgttgagtagggaatatgcaaccaaaattgctgattaaaatattaatactacttcatatatgggtaaagtaatatagccctgagagtgttgttaccatttatatataggaaatattatagatatgattgaactgggtattccgtgataatgatactacttcttgccctctcgtttctctgagtgcagccaaattagcggcgacatgaaatcgtttatatttaaatacattttctaaattaaagacgctcaaacctcgaaaaaagagaagaacaacccgatggccaacaaaaagcgacgaccttgtgattactttgccgctgcttcgacattatatggacgtatactcatcgcacatttggcaacccatacagatgtatctatacatttcggttaccttacttttgtctttcaacgttttttgcatattaattaagcgccaaaagcagcagacaattttgaatattatcagttaatctggcgaggcattttcgagtgtgtttgtatgtttgttgtactctatctatcttaaagttgtacaacgttttgtggagccgcgcaattgcaaacaggttttgtgcaactacaaaataataataacaccaaacaactgagaaatgatttttcttatatccatccacacacacacacacattcgtactatacatgtgggtactttttctccttctttttaacaaaagttcaacgcggtgtgtgagatttttatcatttgtactcaagtggcgtccgtcggctgaagatacacttcgcctctccgtttcacactgcataatttgagggaacacgaagaagttgacaaaagatttttgtgcagcgacaagagatggcccaaccccccgttttgaacagcccctcatggcgaacaagttgaggttgattttttatcagcctggaaaaatctttgacactaaatgagcaattgacttgccgttgagagaggacttttgaagtgcaaaagccgggggcggttgggttgtttgcggaaaatgtcaaggatctgcagctggtagggaagaagtatctttgtatctatactttgaactagtgcagtgcgcgtcataacagcagctggctttgcaggtggcttctttgaataggcataagaatcgagtaaggagaacaaaataagcttctgcaacgacgattgtcaacctctgaggttgaggcaatccttgagatacaaaccagagattagtttagtaaggcggtcgtgctgcctccgtttttcttcatagggtttttgttgctcttgctggctgtgtgcacatgcacgagatacaaactcatagatactactatagccactacagtataagaaacccagcaacttgtccgggtttagtcagttcgttttggcctggctttttcggtttttcgcgctgaggttcagttcatggctgttaaactataaagttgttatgctaattttagtgttggtggcaaccgaatgctgctattttttcttattttttttcctttttttaaccgtttcgatttcttggcgttcgtttcttggttcgtttagaaatgatgaaattgtggagcaacaaagagatcttgaaaattaccacaatttgtacttgtacataagtaatgtgggaatttgagccgccgccgcgaagaagaggagctcaaaataacaaaaatacaatgaagagtaaaaatcgaacaggcaaatacacttaggtccatggctttttttttgttttgtggtacaactccccgatccatttgggccaactttgattgatgatctttgatggtcgggtctccctatctcactcgctgtccctgtatttttcacca

PCR verification status

Line verified as correct.

No slide loaded.