Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT39556 chr3R 6443064–6445159 (2095 bp) hth, CR44018 activityactivityactivityactivityactivityactivity
active
procephalic ectoderm AISN, ventral ectoderm AISN, procephalic ectoderm anlage VDRC

Annotations

stageannotation termintensity
4-6procephalic ectoderm AISN4
4-6ventral ectoderm AISN4
7-8procephalic ectoderm anlage3
7-8anterior endoderm anlage3
9-10head epidermis lateral anlage3
9-10anterior endoderm anlage3
11-12head subset3
11-12epipharynx primordium3
13-14epipharynx2
13-14head epidermis dorsal subset2
15-16head epidermis dorsal subset1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0001235hthoverlapping BDGP FlyBase iFly
FBgn0264788CR4401821937bp upstream BDGP FlyBase
FBgn0037818CG646558218bp upstream BDGP FlyBase
FBgn0037819CG1468860395bp upstream BDGP FlyBase
FBgn0265161CR4423065290bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gctgtttcacagttgtgcagccattgcaagactaggcatgtaacatgatttgagagtcattggagtttaaggatcttcagtatttagagttgtatgttcactgtttttatttataaggtatatagtcgttcaaatcgtgatttattcatataatttgtaggatgtaatcgttttaatattgtttgactgttcctttagtctgtatacttatgttattgcatatatttatttattcaggttttattgttatatttttagttttttgcaccgatattttttaatttaatacataaaaaactgatttctgttaagaagcgcgcgaattttgattccgattaccgcctacaattcatttatcctaagccaaaaattatacaattcatataaaatcagaggtcctgtcaaaaggagctgtatttttaacacggaatttaccagtttacctgcatagttacctgttttggcagttacttgatcttccatgaatcttccttttgcctactaatttttttgtgactttcaacgcttgagaaggcccataaaaggcttaggacacttgttcataaatctacctgatctattgcgactcacaccctctacacagaaagaaacaagaatattcctaaaatttttattactgtaagttatttgaatttagaaatatgcacaacaaagattaaaatccgaggcatttaaaatgtgtttgattgatctataaaacgtatatcctgttttgttctgtgcagcaaaggtcctgcgagctttatttaatttttctccagtcattattcagcctactttaactgacccgaagaaaaatcgatggcaaatttgctggttaaacaaatgtgccgggtcatccaggacgatgtccttttggcattttcgactgttttgctcttcttttgacagccgccgacaaaagtgtcaattccatttcggccagccgacgggcctgtcaacaagcgtggtctacacacgcctaccgcccatcgcccactgccaccccgctaatctcaaggacaccgccggcatcacaatatatttcgtttaactttaggctgtctccttcgatggcataattttgtatacagtggatagagtgaaagggtaaataaaccaatatttagtcggtttattttgacattacacgacatcgtacttgttattagccaatttttaaaaaataaataaataatttactctactccttctatcacccactgtataaaaataatttaatatttatcacgcttgaaaacttttgtccacaaagttaatttccgaaggactttaggttcctaactcacttacctgctgagggattttgatcatactttacctgcaatgaaaataagaaaattgagttagaaaaaggcagatacacagctctggtgttgaggaaaagtcaggaagaaaaacattgggattgggaaatgcaaatgagcggaaggcaacggggattaagatgcaccgagtctttcgtccatccgaatgtgattgtgaccacatgtgttgtgcacccctccagacaaatcctccaaagtacaaactacgaaatccaaaacacaaaattcaaaatcgaatatacgaaatcctcatcccgctcccaagtgactcatccctctcaggaccggtgatcttttcctagcacatttgtcgggaaatgtttttcttctggctgccttttgattgattgccctggaaaaccacttgaaactgtcaagggcgcaattgggggcgggggtgccgttttccaggggagtgagcccatcgaaatgaagtgaaaatcacttttacacagatggaggaaatcgttttcctatgaaaaactacttagtccaaatggaggcgggcgagtaagaagatgcatcatgttaataactaaattaaggaatgagataccatttctaggattacaaaagcggtcgctaaatggacttctaattcgtcaaggggaaatatttcgattgaaaattcaagttataaattgtacaaagcatagcaaataatacatatgaataaactccggttagaatttaatctattatttgaaataaattcaataatttggcaataacaaccggctaatggca

PCR verification status

Line verified as correct.

No slide loaded.