Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT39997 chr3R 7266207–7268390 (2183 bp) sals, CG17230 activityactivityactivityactivityactivityactivity
weak
brain subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14brain subset1
15-16brain subset1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051374salsoverlapping BDGP FlyBase
FBgn0046225CG17230overlapping BDGP FlyBase
FBgn0263520mir-49451707bp upstream BDGP FlyBase
FBgn0037902CG52812963bp downstream BDGP FlyBase
FBgn0037901CG67444783bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cttgctgcgatcgttggtcttcgttggcttcaacttgatgccgccctggatctgcttgagcagcttgttgtgcgagttgcccttctccgtctcgtagatgaacttgtcgtccaatttggttatcgacttgcacgtcaggatgggctgagatctattaggatttgaattgttataaaagagatttttgaacattttcgtgcagagttatctattatttggctgctggtacttctgcacacttaaaatttaagtaaaagtcattaacatttgccggataaagtggcgtaaacgcagtaagatgctctaggtactctttcctgtggccttaaataacttcagttttcattccctttttaattatcgggagtattgcagtcggtaattactgcacagcatgcggacaccactcacctatcgttgcaggccacatggcgcagcttcttgccgctctccacctccttcatcatctcggaccagtcggggcgccttcggggtcgagtcctgcgaatcgaagcgaatcggaattatggccattctgcgccttcaaggtaaaaactatcccgatgccaggatattcgggtatgcaagcactggcggtggtcagggttcatgggtcagtcgtcgaggtttccactcacctgagcttctcgagggtctccttctgtgtgctgctgagcactctcttctcaccgggagctaggggcgggggcggcggtggcggggccttgggcaccagcgagggcagcggcggcggggcgggaactgcaacaataaaacacggaatgcacccaagtgggcggcggttattctctgccaaatggtgggtggggcactcgctgcaagtggtgcaagtgggcgcgaggtttggtcgttgggcattagagcaaatcgccgggcgctgcgtgcactcgcggttattaaatataattttaatttaatgagtttgcaatttgtttcagttgtttgttgttctttcggctcccggggggttccttagtcaacccgccagaggattcgccaccccagtatttagctgtgctttgcgagcaaagttgcaccatacatatcaatacagggcaaagagaatggaatggatggctttacactccgaacattaagggttatttattccttttcggtttttgttttaaaaggttctgactctatcaattccccaattgtattagtttaaatctattttcatcttttcagctagtacattttaaatcacttaaatgccaatcttaagcatatctaacattttccttacaaaacagaggacccaaactattatgtcagctggattatacattttagagaatacattttgggaattgtctagtgttttgaaaaatgtcagttcatcatttcgccttttagccaaacacaatatgaatagaaaaggcttatagtctgtttatctgaagtttcgcctggtgtatggggggctcctaatagaatgagagcctagacacatggctgtctctgtcggaagttgcagcagagattgaaaagttagtgcctgcctccgttgcggcctccgcctacgtttcgtcctcgtcctcgtcctgctcccccgacaccgtcttgtcgtggaacgtggacctggctttgatggtgttttattgccttaacaccattcattcgatttctttgggactcatacacaggcatgcatcaagatgggtttctttcataattttttatcgaatactttgcattccttcatgctttttcctttcggcttgttgttcaaaagtgtaaaagtcaaacaacaaaaagaagagaaaaacaatgaaggcaccaccaccagcaccatcaccatcaccatcaccaagtgatgaaaagctgacaaatctgttaattagctttgtttgagtgagtcctggcaggaagcaggggcaggagatttgatgccttttgggtgggactgtgttaccaaggccacaaccgccagggccttatcctttgtctgagctccggctccggctccggctccttctccgtctccggtttagtctgccttctcctttttcggttttccagtttttcggtttctcggttgcgcctggctggatctgcacttaatctttaagtggttggctgccttttgcggtgcattagtatccgaaataccttccgaaaccccctcgacctgagtgaaaaagaggtggataacttggc

PCR verification status

Line verified as correct.

No slide loaded.