Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT40053 chr3R 7368357–7370488 (2131 bp) dpr4, CR45056 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0053512dpr4overlapping BDGP FlyBase
FBgn0266416CR450566363bp downstream BDGP FlyBase
FBgn0037910CG1470811510bp upstream BDGP FlyBase
FBgn0037911CG1089815141bp upstream BDGP FlyBase
FBgn0037912sea17261bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgcacacacacacaagttcgaaggatacgcggagagaggcattttgtgtatccgtctcagaacgtgaccaacgatgggtccgtgggatttagttattaaacggcttttggcttctgccttcacttcattccttcgtctgttttcatttttaaatgtggcacaatgctatgtggcgatggtgttgctgctcctgctgcttctgctagcactttcccttttcccggtgcttcccttcccgtatgagtgatttatccgacggcaacaacggagcagcgttcacgggcatccttgcatcaggattcgcgtgctggaactgatttcgattccatctcggcgagcgcaaggaacttgcaccgcgactccgaatcgcgagactccgaaaggtgctctcccacgcaggcgcacgacaaaaaggacctctgtggatgcgagaggatttccccgaaagtcagagcatatcaaatattaattcgccatccatttgatgtcgctttctttgcatgcctgatgagcggttttattttaaggcaagggtttattttcttttctttatttcgtcgctttccgtttttcaacacgactcggtcgtactttggttttccagctaaccaccaagccggatcgttttgctctccatccttcctccgtcgcagtctctctttctccctcgctctctctctctctctctctcttgggctttcgccatctgtactatctgggttattagcacaacctgcctcaatgcgagaccgactggtaacagtcgtgccgaatcgaaatccgagtggtggaaatcgtggccagacgaacctaatatgctccatagtcacgtacaaatgaatattcgtagtagagacgccttcgttttggcatattaatatagtctacatttcggggcacaggcaacccgcacttttttgtgtctttctcgcacatgaatgatttacacccgggccatgtaaatgtgatttttaccgcaatatataggtattggtttagccataggtatagccatgggaatccttttagtttatacgccatcgaaccgtaccgcacccatcgccccctccattcgcgcaaaaacaattgaacagacagttataggccaatttcagtttatgtccatgcgtcgcactcgagagagatttgtgtggcttcgttaagggactagaaaacgtggtataggctgtaggctaaaagcgctataagggctataagagggtttaaggggcttatggggtctatgggtgtttgggggtacgaccaacacctgtacctcgtcgtcgttgctgcgccgaccatgtcaaatgttgcgtgttatggccacaaatgtggctgtcgaaagcgtagccaccccccaacctccctctcaaccatccttccccagtacacccgcaagtacacccactacccccgcaacccatccgtattcagaaaactcggaacgggcatttcaacgcatgccttacgagctcataaataaaatgcccacccagtcgaaggccgataaagtcgagtgtgcttgactggggaatgccctgtaggcctcaaaacatcgcaatgcaaatgagcacggcgccggcgaaagagacagacgcactcaaacggacagagataggtggctggcgagcgaatgagatagcaatgtagagaaacagcgagccaatgcaacagaaaattgacagacaatggccctgtaattgacacgccacctagcggccattacgaatgattaaagttgttttgaccctcccaattgtgcgtgtgtgtgtgtgtgtgagtgtgtgttgccacgagttgacatttgattatagaattccattaccaaacaattgaaatgggaatacatcgagttgaccagaacggaggcagagccgcactaagcagtttacaatttctataattaagttagcacgcaatcaggtcaaacggaacacaggaagaagcgatctggataattatagaattatgatttaatatcaaatctgataataatcagttggattaggcgaactctttgagatactattacaaattgagtttttaaggcgattaaaaaaaggcatcaaatctttgaattttatggccatgatcctataacttactgaagatattgcataagcataccgcga

PCR verification status

Line verified as correct.

No slide loaded.