Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT40346 chr3R 7957492–7959585 (2093 bp) tRNA:K5:87BC, CG4702 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0011905tRNA:K5:87BC344bp downstream BDGP FlyBase
FBgn0037992CG47023570bp downstream BDGP FlyBase
FBgn0037993dpr157063bp upstream BDGP FlyBase
FBgn0051361dpr1720351bp downstream BDGP FlyBase
FBgn0261714Cpn31117bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gaacaggactaagggccgtgctgcatgcacacaacatttctgagattccaaagtgggtaatcagctttgaaagacttttgtttaaacgttgccagtcggtttataaataaacataaatgtggagaacaataaaacaggaataagaagttgtgcacagcaacaaggcttttcctattaattatgacttttaaagtcatacaaagcttttctactggtatatcaaaacttaaacggaaaatggatttatttattttatacgtattattagaacaatcgatttaaatgcttctgaatctgcggtcttttaaaatttacgttaaaattccttcgttgcaagttatctgtgcgaacttaaagctataatggattcctaaatggaccacccacttcgcatatttcacggcgccatcaatgacaggacgggaataggtccagaccaccgcccacaaatcaacagccggtcaaatacaggccaggtcagcttcggacagtaatgaacttatgcaaatgagtgagttataccgcgcacagaatattgcatttgaatcaatatcctgaagactgaaggcatttgcatacatgagacttgaaatcagcaggccaggtgaaaatgaaaagtgtggggcaaactgacgaatgcaattgcaaatttcgggaaactagagccaaatcatatcgtgatgaatttgaaatacataagccgacacttgcttttatttaacctttaaagggcttgtatcgtaaaacaacattttttattgccatccatcaaaatgtatttaaacattaaaaatacatacatacaatggcaacattctttcgccctttaaaagtgaaaatcaaacacatgttggccgatttttaccacacaacttcgggcttataatgcaagtttaatcatataacagtgtgtggctgtatttttatataatttagtttgcatggaaatctgcgcaacatccgctggcaggcagatgggaaaggcaaatattaccgacagaaccacgggaactctcctccacaacagctgttgacgaatgtcctggcccaagggtatagggttacgggactcccgccaccgatcctgccgccaaatctctggctctccggttctactctccgcgcattgagcaccggcaaagataaagtacatttctgtgataaatataacaacaagtacccgaggcacgcacaagggcccatcagggctcgggtgaaaacgcatcgaaattttgaagcccaatctgggtttcatgggcgggggcaatgagagggtgatgcactggaaaaaatcccatgttctatataaaaaaaaaagcaatcaacacacttaataatagatttatatgctatgctcaagtcaagattataaaaatattttatttttaaaacagaatcaaaatcgatgacttccgatgcaaaagccatagaattagaattagaaataggatactatttaatttttcttggccaaattaacttactgtgcactttttggcagcagttataatgatgccagcgatacatcatcgcaaaatgctaacattttcggcagccccggcagtcaacagctgttgccgctgatgaatcctttgggtccggccagccaagggtatcgcatcctttgccttgccgctgtcggtgcgagtgagtccctccctcgcccactgatatttcaatattttgcgcataaaaaggagcaagttatttttcatactccgccacacctcttatcgttgtctccttttttccgtttttgctaattttcctaacatagccaaataaatcgtagaaatattcaaatgtttgcaccatggacaaagatatcgctgaagtttgggagcaacaacaacgtaattaacagccatagaatattcaagacacgcacaaaatattccagtttcctattttccacaatcccatttggcagtgaaagagtttgccgtttgtgcttggcaaaaaacacacactcatatgaatcgttttaatttgttgtgcgtgctttgtttatgcgaaagctgcatttgcgaccagttcgttttgaaaattgggaagctaaaaatgctgcatggaagttgaattgggaaggccagt

PCR verification status

Line verified as correct.

No slide loaded.