Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT40919 chr3R 9048109–9050302 (2193 bp) Ace, CG8476 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000024Ace564bp upstream BDGP FlyBase
FBgn0038127CG84761810bp downstream BDGP FlyBase
FBgn0038126CG84837923bp downstream BDGP FlyBase
FBgn0038125CG814129879bp downstream BDGP FlyBase
FBgn0038124CG1438032820bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

aacgccgagctgaagatttacgacaagtggtgactggttgtctccgccgtgcgctggctcatttatctggccaatatacatatgtatatgtgttacctatgcatagctatgtatgtatatatagcgtgctcctttcatcccgacttattatgacgggcaaagagtttttcattggagcatctgatagccagtttacgagggcttctttcggggctccatgctgggtcaatggacaggaacgttgccaagaagtctgcgccggctatggctcatcgattcgattcgagttcgagttcgagttggctcgacatctcgacttctctaattctcatcttggttggtttatcgagtcgcagcacggcatacagcgaaatttaaattattcatatgtcaggttgaaggctgcttttgctgccgctgctgcctttcgcgtgtaaaaagctatttgatcgcaagattaactccgctcggcgattgtccgcggatcaattaaaactaagtaatggcgtctgtgaaaccagctagaaacggaaatacacaaaacttcgcaaatagacagcgtttgcatcaatcaagtggaacaattttatttgtttttctggtgaataagttaagcgggggaagtacgagttttaaagcgtgtgagggtgtccaacacttttcctctttcaacatcttacaaaactattcagtttaaaagtgcctttcgaagccctggattcctaaattcgtcttattctacatattctgtcttctttatagtctctcgttatcaaatttttatcactggtttccgtttcttagcctaactatccttcaatcagactttccgttgctttccgaggaagtaaaatacaatacaatggtgccctgataactattaacattttggttagaggtatttaaatagcactccatttagccactaattagccaggtcttcaggtagacaaacaccgaggtggccacatgggttatgtgctgcgcaaattctgcaaaagaagatacagaaatagcataaactttactagataaaccgggcataaagagacttaacgactatgtactcaaataaagtatccgccgactgcaggtctaatttgcatttacaaagctgtcggctcttttgagtcgcagtcgcgttggccctaatgacaatgcatcttcttcctttgcatactctttttaaaaaaaggtcattcagttttcgaaagttttcgatatttaaacctctcgttacttcgacaagtttctggcttgatccaaaaaacacaaaaaacttaattatctagcagtctgtgaagcaataaaaggaagttttttaatattatctacaacatttttgtagattaaataaggtttacattataaaagaaaaatttaaatttgtatatgtttatatatatttttgaaaagaaagttttctctatcggacaacgaaaaaaactaggcgatataaatataatatttaaaattcaagaatgtaagataatacgaaggcatcataacacctgcatcaataatgtaaattatgataattccaaaaagaaatatccacgactgtgtagatacactcacatgcacaaatgaattggaaggtgaatattttcctatgatttccgagcagagtatgcgatattcgttaccctcagaaccaaaacaagatagactttccacagtgcgaaggcttagtctcgggtcggggccactttaacttttactacggatgcgaaatggcgaccgtaaatgaagccctgaaccccgggcaaattgacaaatgttggcacgcaaattagggagacgggcggcggcactgtggtcaccatgggcttttatggggcacctttcgttttaatttgccgtgattaatttgcatatttcggcctgcagtcggcatgcggaagtggcggcataattgtggatttatatgcatcataaattaagttttctgcacttgggctgggcgggcggttaagtacgcgattttatttggtgtttatcatttcagttttattgatttaatgcaaatgcaaagtgccgtgtaattagcagccgctaagtcggagtgatagagctgttgtctcagatgagaggcgcttcctgaagccgataatgacttactggaaaaatatggacaaaggtgcaaatgccattgggaaatgatcgacggttggggcgggaaataaaagcgagt

PCR verification status

Line verified as correct.

No slide loaded.