Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT41037 chr3R 9274311–9276457 (2146 bp) CG14372, CR17025 activityactivityactivityactivityactivityactivity
active
visceral muscle broad, visceral muscle primordium broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12visceral muscle primordium broad3
13-14visceral muscle broad5
15-16visceral muscle broad4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038156CG143722001bp upstream BDGP FlyBase
FBgn0040554CR170256922bp upstream BDGP FlyBase
FBgn0261814CR427569381bp downstream BDGP FlyBase
FBgn0004049yrt13608bp downstream BDGP FlyBase iFly
FBgn0262323mir-25215630bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgggctagcaagactgacaatcgaaatatacttttcttccagtgcttcatttttctaattagttatttttgactatttttccccagtgtattggaagaggacttatgggagtgggcggtggtgggagtctggtgtgctggcgactggggctgagtgcactgccatctcacttgagaattctcacacctcgtggctgtcagtccaggtttttcgggatatttgggagtcggtttatcttgggggatgcggcgcggcgcattcacgtgccaggcttttgatctgtttagcattccgtggcacatcggaaagtcgtaactattgacaagatctggagcaccaccaaacggtcaggtcattggagagaaatgtctgggagtcgaatgcatttcatgcggcactcgtgtatttgtttgcattaatttgtatatgttactttaacgatttaatgcccagcacggcaccgacccgacgcagattccatagaaacgggaggggaatcgattcgagtccaggccaggcacgggcacccaatggagttcgatcccccattcaccattcaccattccccaatcccaggtgactgcactcggcggggatttttctctggctttttggtttggttttggccgggcgcaaattgctcgggcgcttctttactacttcctttccatatcaaattgtgtggatattgcgcatcaatcacttgataaagaacaacaatgcagcagcactcgcatgatgaataacatctgctctggtcgaatctgaattaaggcgcaatgttgtgccgcaaaagtgaataattcaggcgagcaaatattgttcgatttaattaatttccaattggctgtctaggggattattattcatcgcgaaggctcatttccgacaggcctcattttccagtgcttgaaaaatattttacttggctttaatttgctgtgtactaaggtgtaatttttcttaatatgtagcggatgcatgcaggaagtacaaatttaaacaaaaataatccatttaccgctgtttgcattcaaacaataaaacaaaatccgaattggaattttcttttcttaacattttcgaagaaaatcttttaaaagatgctcgtttaaataaagtatttaggttaaaaacactattaggaaaaatcgaagaatgattataatacaatttgtttaagtttcctttgtaagtgtattttaaaatgttgctataaaccaaattgtagtaagctaatgtactacatacaaaaaattagatgtccaattttatagacaataaataaacaaaggtttcttaatatcttcataagttttgccatcgctgaatagcaatttaaaatgcttttctatcatctaggcaacaactttcaagtcaagcaggcctaatacttgggcctaacttaatgtggaaatcccccaacaacatccgcgaatatttgccaaaacgattattcatctgttaagcagggagtatctgctgccgatatggaacatggtgtaatcgtgtctagctctaattacttttacagcgacaacttttatcgcccatcgcagcgaatatctccggattgaggggcaatctttacgcataaataagcagaaagtgggtggtgggttcttttgttggcgacccgtaagaagaggaaatttgtcaataccacttttagtagtggcttttaaagcaggagggctaaaggcatacgcatacgatataggtcgctgttaagatccgaatatcgtatgccaagtttcgtgtggctcgctctttcgggcatttctcttcggctggctattcgaatttcgagtttcgaactcaaatcaaagcagacgtcgcgaggaaaacgcatcgacgagtggaactccgacgatgggtatccagtagatacgcgaagctataacggtacacatgttgctgtcggaaaacgcgagcggtccaagtggaaatgtagcccaatccgttcgcaccagggtttccatttaaagcgctccctcgcacaaatacacacacacacaccgaaacacggacacactcgtacactcacacactcgcaacgtaacgcacaccaacgcgtattcgcacccacacacaagtgaagtcggctctgcaaacgcacaagtgcggtgtatctgtgtgagtagcca

PCR verification status

Line verified as correct.

No slide loaded.