Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT42351 chr3R 11814891–11816988 (2097 bp) srp, CR44133 activityactivityactivityactivityactivityactivity
active
yolk, anterior endoderm anlage, posterior endoderm AISN VDRC

Annotations

stageannotation termintensity
4-6posterior endoderm AISN3
4-6yolk4
4-6anterior endoderm AISN3
7-8posterior endoderm anlage3
7-8anterior endoderm anlage4
9-10anterior midgut anlage3
9-10posterior midgut anlage3
9-10trunk mesoderm anlage2
11-12posterior midgut primordium3
11-12trunk mesoderm primordium3
13-14amnioserosa2
15-16amnioserosa2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0003507srpoverlapping BDGP FlyBase iFly
FBgn0264982CR44133overlapping BDGP FlyBase
FBgn0022787Hel89B5719bp downstream BDGP FlyBase
FBgn0262028CR4283915152bp upstream BDGP FlyBase
FBgn0002783mor16256bp downstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

aaaattatataacccaacaatggaagggacaatattttccctgacgttgtcagcgaaaacaaattcataattctgtttatttgcttggtccgagagcgaaaggatcttgaaggacatcgaagggatcgagggaaccaagtgagcacgagatgcggcaataacaataacaaccgcatcccctgggtgtcctgtctgttgtccgctgtccccttccccttgccacgatcgatttgtatcgtgtcggcgcgtgttgccattttgtcctgtttaccgtgccgcaggccactaactatccgcttacctggacgggtcacccgaaatgggaatcctacctgaacgggcaaatggcagccgtctgcggcttggccggccgattagcgctgatcattgcggcttaatcgtggcttcttgacagtttccaatactaactctatttaaataggttcaattgacgttttttgtttgtccggctgtgggaaaaaacttctctcaaatgtgcagaaaatatgttcggccagtccaggaaagtcagtcggggattgttccaagcaaagccgcttgaccatattacctaatgatgtgtttacttatttaattcaacgtcacatgcgccagtgttgattctacaaattggataagtatgccatgtaaattgtatttgcataaaattggaaaattactaagattgttaacactgacatgtgggcaacagaaaaatcttttttttcatatgtttgtataccaatggacactatcattgaaaaaacagtgtttttttagatattactaaaaactagtttaataattccttaaaatgttaattttaatccttgactttaagaaatctttgaacttaatttgatcaaatgtgacaaaatcgttagttttcccattcttgtatctccgcacagcatcggaagataacccgaaacaattgagtcgcttattgttgcattaaaagagtgttaaagacatgttctcaatggccattaaatgggtttgataagagcacaactttgtggcaggccgcaggccacttgaatcggatctggccggtttattgtaggagttttatttgaatgcctaccacataacgatgcagataattggcgcttaaggagtcaaacgacttgtatccaaaagataggcgaacactcagcactcaacaaagagctcttcatgaaatggatccgtggcgtattggattaccagcgcaatatttatggccgcgatgtacacgaaaatattaaaaatgcataaatacatcggcaccgagactatgaacgatcatcgtacatcgtcctgatatgtgagacactcgccacgcttgacacttgtttgaggggagtggagcggggaacctgccccgggtaacccattttcggccaccataaatatgtcaaaatagtttgaagccaaacttagtggcattaaaccctggatttcgtgagtacgtgtgcgtttcactttggtctcgtgggatatacaaataagaatgttctgtttgaattggacctcagtggatttactaatgtcccaatgtatcgtacaaaacttattaaacgacttttcgccataaacaatggctattcgataggtaacctccccccctccgccaacaaaaatcagagagctgtgccacggcccattgacaatcggagatcgagtgtgaaaaagggcacctcctagcccgcagacccacaagattatcctttcccaaggacttgtaataaatcacatcattagcatagcatctcctagtgatttatcgtttcgggagatcgctctggagcaagatcctcatgtttgttgacactgcacatgctcctccgaatcccccacacactcatctgaattgtccgatctgcggatcttttcgaagggcggggcactcagccctgactcacatttaaatgcgtagttcttcaccatagtctagtggctttaaggccgcctaccgttatttgcatgtgtactcaatgcatttcgtttatagaagcccgacttatcagacctaactaagcataacattgccagcttggggtcacaggcaaaagagggtcaaatcggatggggagctcggctaggtaaatactga

PCR verification status

Line verified as correct.

No slide loaded.