Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT42357 chr3R 11829607–11831873 (2266 bp) srp, CR42839 activityactivityactivityactivityactivityactivity
active
midgut chamber, malpighian tubule, ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14ventral nerve cord subset2
13-14brain subset2
13-14midgut subset2
13-14malpighian tubule2
15-16ventral nerve cord subset2
15-16midgut chamber4
15-16brain subset2
15-16malpighian tubule3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0003507srpoverlapping BDGP FlyBase iFly
FBgn0262028CR42839436bp upstream BDGP FlyBase
FBgn0038391GATAe5220bp upstream BDGP FlyBase iFly
FBgn0264982CR4413310221bp downstream BDGP FlyBase
FBgn0022787Hel89B20435bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

aaaaggcaaatgaaaacgaaaaagaataacaatcgaagtaaccaataatctcatgcaattagctattaatttatatattttttatagcattattatatatttaatgcaatttaagttttagtctggtatattttttaacatcatatttgcaatattaattttatttctcttgagttaataaaagacaattgtccctgaaatgttctgaagcgaggtttttattaacaactttttcagggagagtttttgacaacgtggcgtatgcgaaatgtcattgagttgttaagtgttgttaagtatttcaatttcaaccgttttctgtatggcttaaccctgaaagtagacaccttagttcgaatgtatgccctcgtaagtatgctacatatttctactttacatgtaaggtaaaattatccatattttacatattttttttaacttcattctatttgttttggatccaaaattcctctgaacttaacctaatgtgtgtataaaggtatatgagaccaagtggtttcttaattatattttacaagctaatatcacgtcagattaaatgttattttatgaatgtgatctttatatcggaaatttataaaaaatttaacttaatctgattgctagataagaatagctgctaattaaattctctgccgtttttgtcatgtaagatgacttcatatatttatacttatttaacatgtagttttaaatacttattgacccttttagttagttggtaatacttttttattttctttaaatgtgatattagtacaaaaagagaattattagaacagtagagtatctaattgttttttattagagaataatggaaaagggacagctattcgaaaaaagtatacttataggtaggtactcaatgtgtactacacatctttgataggtgcaaaaatttgttatagatataaagcgcttatttatgaaaaataagggaatacatacagatacacttcagatacattttaatatattttctgatttttaggagatatgtaaagtggatgtcctctacgcagagccactctagaattaagcaattacaggcgagaataaaatatcagagagtggatgtgcatatgtacatacatatgtgtgggggatgtacatatgcacatgcacacatatatgtacgttggggtggagtaagtgtgtattatattattttgtgcgccgccatttacgaaagcgacattttcagtgataagataacgtcacattgctgagtcccctccgttctgtctctgtcacacccccgccttctccctctatttatatttttcgctctatttcctttttaataaactttcagtgcgctggttgccgttgttgttcttgttttttatgggagtcacgcgttacaaaacgacaacagcaacaaaatctgaaagtcatttcatgtggcaaaacagtttttgtttattgctagggttgtttgctcgccgagttgtggggatcccacagagagggtctgtaagggggtgggtcggtaagcgtggaggtggcgctggtgggtggcagtgggaggaacgaggtggctgcctgactacgtgactgtacaaaagttgggtaaagtcgcgagtgccgctcgttgaaatggctcgtgcaccactcgagtggtgctgaggtggctccgtccagtaatttgattgatacccctgttgattagccgtgaaatgaagtccattcaccataaattatttctgtagtcaacattggggcattggggcttcaaaatgaattgcaaaatggtcgcctttcttcctgcaattgttaaataccgctatcatgtgtttttcagatgtaatcggtcgttgctcagatatatacgcataactttcactcaacagattgctagtttcttcgctacgggtcagggtttcacaattgaaacttgagcaaataaagaaatgataatgccaagcatatagccttgccttgcccgatatcatgaacgataagataaagtttgcctatgttttcgttttcaatttttcgggacctgtatgtaaatgaaaaaatcactatgaaaaatgaaactttagaaaatccaataggaagatttggatggtggtggcaaatttccaaaatggttgacactaagtaaaaactcgtatggatatatgagtaaccctaatttacttagccatgacaacttggaattattgtttcgtaatcatttggctgaatttgtttattcttcttttataagagcttaggctttaatgtttgctgctggtaaa

PCR verification status

Line verified as correct.

No slide loaded.